Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

Mutasyon Analiz Teknikleri I Prof. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları.

Benzer bir sunumlar


... konulu sunumlar: "Mutasyon Analiz Teknikleri I Prof. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları."— Sunum transkripti:

1 Mutasyon Analiz Teknikleri I Prof. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları

2 DHPLC Transgenomic/ WAVE

3 DHPLC BRCA ex1 CAATAGGTAGCGATTCTGACCTTCGTACAGCAATTACTGTGATGCAATAA GCCGCAACTGGAAGAGTAGAGGCTAGAGGGCAGGCACTTTATGGCAAACT CAGGTAGAATTCTTCCTCTTCCGTCTCTTTCCTTTTACGTCATCCGGGGG CAGACTGGGTGGCCAATCCAGAGCCCCGAGAGACGCTTGGCTCTTTCTGT CCCTCCCATCCTCTGATTGTACCTTGATTTCGTATTCTGAGAGGCTGCTG CTTAGCGGTAGCCCCTTGGTTTCCGTGGCAACGGAAAAGCGCGGGAATTA CAGATAAATTAAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCT GGACGGGGGACAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTC AGGAGGCCTTCACCCTCTGCTCTGGGTAAAGGTAGTAGAGTCCCGGGAAA GGGACAGGGGGCCCAAGTGATGCTCTGGGGTACTGGCGTGGGAGAGTGGA TTTCCGAAGCTGACAGATGGGTATTCTTTGACGGGGGGTAGGGGCGGAAC CTGAGAGGCGTAAGGCGTTGTGAACCCTGGGGAGGGGGGCAGTTTGTAGG TCGCGAGGGAAGCGCTGAGGATCAGGAAGGGGGCACTGAGTGTCCGTGGG GGAATCCTCGTGATAGGAACTGGAATATGCCTTGAGGGGGACACTATGTC TTTAAAAACGTCGGCTGGTCATGAGGTCAGGAGTTCCAGACCAGCCTGAC CAACGTGGTGAAACTCCGTCTCTACTAAAAATACAAAAATTAGCCGGGCG TGGTGCCGCTCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTAGAAC C with 851 base pairs Melting temperature of entire strand: 61.25° Temperature = 55° Celsius: 1-3, Temperature = 56° Celsius: 4-5, Temperature = 57° Celsius: , Temperature = 58° Celsius: 6-6, , , Temperature = 59° Celsius: 7-48, , , , Temperature = 60° Celsius: , , , , Temperature = 61° Celsius: , , , Temperature = 62° Celsius: , This sequence should be run at all of the following temperatures to ensure detection of all polymorphisms. Recommended temperature: 62° Recommended temperature: 56°

4 DHPLC CBP Exon 6 A. Rothan’dan

5 DHPLC A. Rothan’dan

6 DHPLC A. Rothan’dan

7 DHPLC Ezzeldin et al. Ann Biochem. 2002;306:63-73.

8 DHPLC

9 DHPLC = denaturing high-performance liquid chromatography. Ezzeldin et al. Ann Biochem. 2002;306:63-73.

10 Karıştırma testi DHPLC P300/EXON G->T E1014X

11 CBP/EXON INSA Karıştırma testi DHPLC

12 DHPLC HDAC2 EXON1 Karıştırma

13 HDAC2 143InsCAG

14 DHPLC HDAC2 EXON12 Karıştırma

15 HDAC2 1573DelA HCT15

16 SSCP HSUV39H2 -11InsA (?)

17 Kapiller Elektroforez

18 Genel Primerlerle işaretleme

19 P G>T (E1014X)

20

21 CBP IVS21-4del22

22

23 CBP IVS31-7InsA

24

25 TGCE Temperature Gradient Capillary Electrophoresis =383&BMDRN=2000&BCOB=0&c=53494

26 Mutasyon Analiz Teknikleri III Prof. Dr. Hilâl Özdağ Hafta IX PCR Temelli Genetik Analiz Yaklaşımları

27 Bir sonraki aşama…. 1. SSCP, HA, DHPLC, TGCE benzeri bir teknikle saptadığınız ve incelediğiniz DNA fragmentinde konformasyonel değişime neden olan dizi değişiminin ne olduğunu ortaya çıkarmak, 2. İncelediğiniz DNA fragmentini bir indirekt yöntemle analiz etmeden doğrudan dizi bazında değerlendirmek, 3. Klonlamak üzere hazırladığınız DNA fragmentine klonlama öncesi aşamalarda (PCR) hatalı bir baz girip girmediğinden emin olmak için  Bir sonraki aşama DNA dizi analizidir.

28 DNA DİZİ ANALİZİ

29 PCR TEMELLİ MUTASYON ANALİZ YÖNTEMLERİ  MUTASYONU ÖNCEDEN BİLİYOR VE YENİ BİR ÖRNEK GRUBUNDA VARLIĞINI SORGULAMAK İSTİYORSANIZ  RFLP ( Restriction Fragment Length Polymorphism)  ASA (Allele Specific Amplification)  Primer Extension

30 PCR TEMELLİ MUTASYON ANALİZ YÖNTEMLERİ RFLP AGATCT Yabanıl Tip Allel Mutant allel TCTAGA AGAGCT TCTCGA RE kesim bölgesi RE bölgesi kaybolmuş

31 PCR TEMELLİ MUTASYON ANALİZ YÖNTEMLERİ ASA

32 Primer Extension : Bağlanma: Primere bir nt eklenmesi Uzama: Saptama: Floresans

33 Primer Extension :


"Mutasyon Analiz Teknikleri I Prof. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları." indir ppt

Benzer bir sunumlar


Google Reklamları