Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

DNA TİPLEMESİNİN ADLİ TIBBİ UYGULAMALARI FORENSIC DNA Ref: Dr.Oğuzhan Ekizoğlu İstanbul Tıp Fakültesi Adli Tıp Ana Bilim Dalı Yrd.Doç.Dr. Alper Tunga Akarsubaşı.

Benzer bir sunumlar


... konulu sunumlar: "DNA TİPLEMESİNİN ADLİ TIBBİ UYGULAMALARI FORENSIC DNA Ref: Dr.Oğuzhan Ekizoğlu İstanbul Tıp Fakültesi Adli Tıp Ana Bilim Dalı Yrd.Doç.Dr. Alper Tunga Akarsubaşı."— Sunum transkripti:

1 DNA TİPLEMESİNİN ADLİ TIBBİ UYGULAMALARI FORENSIC DNA Ref: Dr.Oğuzhan Ekizoğlu İstanbul Tıp Fakültesi Adli Tıp Ana Bilim Dalı Yrd.Doç.Dr. Alper Tunga Akarsubaşı

2 Summary  What is DNA?  Where is DNA found in the body?  How does DNA differ among individuals?  Forensic DNA Analysis  DNA and Statistics

3 What is DNA? What does DNA stand for? What does DNA do? • DNA contains genetic information. • DNA codes for the proteins our bodies make that are necessary for survival. Deoxyribose Nucleic Acid or Deoxyribonucleic Acid

4 What is DNA? DNA is a code for making proteins AGC TAG CTT ATA CTC TAT CTC TTT Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid The order of amino acids determines what type of protein is made.

5 What is DNA? Some common proteins are:  Hemoglobin - carries oxygen from lungs to cells  Insulin - regulates metabolism  Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy DNA also determines how much of these proteins each cell makes.

6 What is DNA? What does DNA look like? Double Helix Like a Twisted Ladder

7 What is DNA? What does DNA look like? Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Base (Rungs of Ladder)

8 What is DNA? The DNA ladder is made up of building blocks called nucleotides. What is a nucleotide? Phosphate Group Deoxyribose sugar Base Adenine Cytosine Guanine Thymine

9 The 4 Bases A Adenine G Guanine C Cytosine T Thymine

10 The 4 Bases G C T A

11 A pairs with T G pairs with C The bases pair up to form the rungs of the ladder.

12 What is DNA? DNA is written as the sequence of these bases: AAGTCGATCGATCATCGATCATACGT • In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell. • Only one side of the ladder is written.

13 What is DNA? Among humans, most of the 3 billion bases in the DNA sequence are exactly the same. • Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another. • Human DNA is even 98% similar to chimpanzees. • NO TWO PEOPLE HAVE IDENTICAL DNA* *except identical twins

14 What is DNA? Stupid Facts: •If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference. •If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide. •If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).

15 Where is DNA? DNA is found in the cells in our body. Nucleus (Brain of the cell) Mitochondria (more later)

16 Where is DNA? All types of cells in our body contain a copy of the same DNA. Some cells important to forensic science are: White Blood Cell Sperm Cell Cheek Cell

17 Where is DNA? DNA in the nucleus is packaged into Chromosomes

18 Where is DNA? (one from Mother) (one from Father) Chromosomes come in pairs There are 46 chromosomes in each cell. (23 pairs)

19 Where is DNA? What are sources of DNA at a crime scene? • Blood • Semen • Saliva • Tissue • Bone • Teeth • Hair • Maggot Crops DNA can be recovered from any substance that contains cells.

20 How does DNA differ among humans? DNA is a sequence of 4 possible letters GACT Of the 3 billion letters, 99.8% of the sequence in all humans is identical. There are several ways the sequence can be different.

21 How does DNA differ among individuals? 1. One of the bases (letters) can be different. Person 2 AGCTAGATCGTCATTCCGAG Person 1 AGCTAGATCGTTATTCCGAG

22 How does DNA differ among individuals? 2. Bases (letters) can be added or removed. Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4 AGCTCCGAG

23 How does DNA differ among individuals? 2. Bases (letters) can be added or removed. Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4 AGCTCCGAG

24 How does DNA differ among individuals? Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 3. Regions of DNA can be repeated a different # of times

25 How does DNA differ among individuals? 3. Regions of DNA can be repeated a different # of times Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT

26 Forensic DNA Analysis Basic Steps in Analysis Extraction: • Separates DNA from sample Separation: • Separates amplified fragments according to size. Amplification or PCR: • Amplifies small portions of DNA (STR regions)

27 The Thermal Cycler Amplifies DNA

28

29 FMBio Separates Amplified DNA

30 Forensic DNA Analysis Color image of gel

31 Forensic DNA Analysis Black and white image of STR gel. Samples will have one or two bands at each loci. Gel Electrophoresis

32 ABI 310 Genetic Analyzer Separates Amplified DNA

33

34 Forensic DNA Analysis 13 loci used in CODIS

35 DNA and Statistics The final result is presented as a statistic. Do Say: “The chance that another person has this DNA in the bloodstain is 1 in 300 billion.” Do not say: “The DNA in the bloodstain is John Doe’s DNA.”

36 DNA and Statistics Where do the statistics come from? First, the frequency of each allele is estimated using data from a population data base. Locus: D5S818 Alleles: 7,9 Allele frequency from database 726% 911%

37 DNA delillerinin toplanması ve saklanması  Kriminal araştırmaların başarılı şekilde sonuçlanması için fiziksel delil incelemesinin ilk dönemi çok önemlidir.  Yakın zamandaki olgular delil toplanması ve saklanması metodları hakkındaki bilgilerin mahkemede titizlikle incelenmeye ve itiraz konusu olmaya devam edeceğini açık bir şekilde desteklemektedir.

38  Gerçekten mahkemede DNA testinin kabul edilebilirliği için, kalan bir kaç itirazın çoğu metodolojiyi ön plana almaktadır. Bunlar ;  Örnek toplanmasının başlangıcını  Örneğin saklanmasını  biyolojik delilin işlenmesini

39 GENEL TEDBİRLER  Herhangi bir tipte biyolojik materyel alınırken, kan ve vücut sıvıları için genel tedbirler izlenmelidir;  Kanla taşınan patojenler fazlaca yaygın olduğundan, kaynağına bakılmaksızın tüm biyolojik örneklerin enfeksiyöz olduğunu farz etmek akıllıca olur.  Biyolojik delille direkt temastan kaçının,  Biyolojik delili hazırlarken yada üzerinde işlemler yaparken eldiven giyin,  Yemekten-içmekten sakının

40 DNA KAYNAKLARI Mitokondrial DNA analizleri dışında, DNA analizi için uygun deliller, nükleuslu hücreleri içeren biyolojik substanslarla sınırlıdır.  Kan ve kan lekeleri  Semen ve seminal lekeler  Dokular ve organlar  Kemikler ve dişler  Saç ve tırnaklar  Tükrük, idrar ve diğer biyolojik sıvılar

41  Göz yaşı, ter, serum gibi diğer biyolojik delil türleri nükleuslu hücrelerden mahrum olduğundan standard DNA analizleri için uygun değildir.  Gastrik sıvı ve gaita lekeleri gibi diğer materyellerden DNA izole edilmiştir.  Bununla birlikte bu materyellerin olgu örneklerinden yeterli DNA elde etmek güçtür.  Hatta adı geçen örneklerden sıklıkla DNA tiplendirilebilmiş olmasına rağmen çoğu olguda, örneğin kalite ve/veya miktarı DNA analizi için uygun değildir.

42 DNA profili elde edebilmeyi etkileyen faktörler DNA profili elde edebilmeyi etkileyen faktörler  Örneğin miktarı  Örneğin bozunması yani degradasyonu  Örneğin saflığı

43  Toplama ve saklama yöntemleri bu 3 konu üzerinde ciddi etkiye sahiptir.  Amaçlanan test için yeterli DNA’nın elde edilmesini sağlayacak kadar çok miktarda materyel toplanmalıdır.  Ortamdaki kir, yağ ve diğer pisliklerin alınmasından kaçınmak esastır.( - PCR)  Örnekler toplandıktan sonra hemen adli tıp laboratuvarına teslim edilmelidir.  Parçalar laboratuvara teslim edilene kadar soğuk ve kuru ortamda tutulmalıdır.

44 Genellikle biyolojik deliller 2 yoldan biri ile transfer edilir :  Direkt deposit (döküntü) : Örnek direkt temas eder  Sekonder (indirekt) transfer : Bir aracı yoluyla taşınabilir. Sekonder transferde orijinal kaynak ile (DNA delilinin donorü) hedef yüzey arasında direkt temas yoktur.

45 DNA Delilinin Belgelenmesi Suç alanında delil :  Delilin dokunmadan, hareket ettirmeden veya almadan önce fotoğrafını çekin  Delili ve suç alanındaki nisbi lokalizasyonunu video-teype alın  Delilin durumunu ve yerini belgeleyin  Olay yerindeki diğer objelerle delilin uzaysal ilişkisini (3 boyutlu) not edin, krokisini çizin  Delil paketini işaretleyin, numaralayın ve mühürleyin

46 Adli Tıp Laboratuvarında Delil :  Delil paketinin mühürünün durumunu, işaretini, numarasını not alın  Paketi örnek toplayıcının adı, laboratuvar olgu numarası ve tarihi işaretleyin  Doğru örneğin teslim alındığından emin olun.  Paket içeriğinin fotoğraf ve/veya krokisini not edin  Herhangi bir örneklemeden önce materyel üzerindeki biyolojik delilin durumu ve yerleşimini belgeleyin.  Eğer herhangi bir hazırlık testi yapılacaksa, testin natürünü ve sonuçlarını kayıt edin.

47 Otopsi Salonunda Delil :  Cesedi temizlemeden önce cesedin ve ek delillerin fotoğrafını çekin  Delili not edin ve krokisini çizin  Temiz aletler kullanarak her delil parçasını sistematik olarak toplayın  Uygun toplama kaplarına her delil parçasını ayrı ayrı paketleyin  Toplama kabını işaretleyin ve toplanan örneğin miktarını not edin.  Örneği uygun şekilde saklayın  Giysileri dikkatli alın

48 Kan ve Kan Lekeleri Bir Bireyden Kan :  Antikoagülan olarak EDTA içeren vakumlu bir tüp içine en az 5 ml. kan alınmalıdır (mor kapaklı).  Eğer geleneksel serolojik ve/veya ilaç yada alkol analizleri yapılacaksa ek tüplere kan alınmalıdır.  Her tüp tarih, saat, olgu adı, alım yeri, alınan miktar, olgu sayısı ve örnek sayısı ile işaretlenmelidir.  Kan örnekleri buzdolabına konmalı ve mümkün olduğunca çabuk bir şekilde laboratuvara gönderilmelidir.  Eğer serolojik testler yapılması düşünülüyorsa kanın dondurulmaması gerektiğine dikkat edin.

49 Suç alanında sıvı kan örnekleri  Steril iğne veya disposable pipet kullanılarak alınmalı ve temiz tercihen steril bir test tübüne nakledilmelidir.  Bir kan pıhtısı temiz bir spatüla kullanılarak temiz bir test tüpüne aktarılabilir.  Temiz bir pamuklu kumaş sıvı kan yada kan pıhtısının emdirilmesi için kullanılabilir.  Kan paketlenmeden ve laboratuvara teslim edilmeden önce hava ile kurutulmalıdır (fakat direkt güneş ışığı altında değil).

50 Kar, Buz veya Su İçindeki Sıvı Kan  Kar yada su içinde bulunan kan örnekleri daha fazla dilüsyondan kaçınmak için derhal alınmalıdır  Bu örneklerin en konsantre kısmı ve mümkün olduğunca fazla miktarı temiz uygun bir kap içine alınmalıdır (örneğin örnek fincanı ile) ve dondurulmamalıdır

51 Islak Kan Lekeli Giysiler  Islak kan lekeli giysiler temiz bir yüzey üzerine konmalı ve hava ile kurumasına izin verilmelidir ( direk güneş ışığı, sac kurutma makinası kullanmayın )  Kapalı, hava geçirmez kutu yada plastik çantaya konmamalıdır. ( degredasyon )  Giysiler ve lekeler kuruyunca temiz bir kağıt ile paketlenir yada kağıt kutuya konur

52 Büyük Ve Taşınamayan Objeler Üzerindeki Kuru Kan Lekeleri Büyük Ve Taşınamayan Objeler Üzerindeki Kuru Kan Lekeleri  Kan lekesinin şekli fotoğraflanmalı, belgelenmeli ve krokisi çizilmelidir  Kan lekesi temiz bir kağıt üzerine kazınmalıdır.  Alternatif olarak, her bir leke yüksek kalitede bir yapışkan band kullanılarak yüzeyden kaldırılabilir.  Eğer band bulunamazsa, örnek, distile su ile nemlendirilmiş numune kumaş ile lekeli alan sürtülerek alınabilir.  Son olarak obje üzerine bir kaç kez pipetle küçük miktarda distile su damlatılırak, leke serbestleştirilir ve daha sonra örnek temiz bir test tüpü içine aktarılır.

53 Ceset üzerindeki kan lekeleri  Ceset üzerindeki kan lekeleri örnek alınmadan önce tamamen belgelenmelidir  Lekenin yeri, büyüklüğü, miktarı, şekli ve paterni not edilmelidir  Cesedin deri hücrelerinin alınmasını minimumuma indirmek için leke mümkün olduğu kadar nazikçe alınmalıdır.  Tırnak altlarındaki kan lekeleri temiz bir kürdanla kazınmalıdır. Tırnaklar temiz bir tırnak makası ile nazikce kesilmeli ve alınmalıdır

54 Semen ve Seminal Lekeler  Semen delilleri belgelenmelidir  Sıvı semenin temiz bir test tüpüne aktarılmasında, temiz bir iğne yada disposable pipet kullanılmalıdır  Daha önce anlatıldığı gibi her biri işaretlenmelidir  Örnekler buzdolabında tutulmalı ve mümkün olduğunca çabuk laboratuvara teslim edilmelidir  Alternatif olarak sıvı semen temiz bir pamuklu kumaş parçasına yada swaba emdirilebilir. Daha sonra örnek kurutulur

55 Taşınabilir objeler üzerindeki seminal lekeler  İç çamaşırları, giysiler, çarşaflar, yastıklar ve diğer taşınabilir objeler üzerindeki seminal lekeler o haliyle alınır  Leke hala nemli ise hava ile kurumasına izin verilmelidir  Her örnek ayrı ayrı temiz kağıt kutuya konarak paketlenmelidir  Örnekler mümkünse buzdolabında saklanmalı ve mümkün olduğu kadar çabuk laboratuvara teslim edilmelidir

56 Doku, Organ ve Kemik  Her delil örneği not alınarak açıklanmalı ve fotoğraf, kroki, videobandlarla belgelenmelidir  Her örnek temiz bir çift forsepsle toplanmalı  Her örnek temiz ve fiksatif içermeyen bir kaba yerleştirilmelidir

57 Sıvı Örnekler  Sıvı idrar yada tükrük mümkün olduğunca çabuk temiz steril bir kaba (plastik yada cam örnek kabı) alınmalıdır Saçlar  Saç deliller temiz bir çift forceps ile toplanmalıdır  Her örnek yada saç grubu ayrı olarak paketlenmelidir  Saç kökü dokusuna zarar vermemek için toplama sırasında dikkatli olmak gereklidir  Eğer saçlar nemli vücut sıvılarına bulaşmışsa, gönderilmeden önce hava ile tamamen kurutulmalıdır

58 Ceza Muhakemesinde Beden Muayenesi, Genetik İncelemeler ve Fizik Kimliğin Tespiti Hakkında Yönetmelik Ceza Muhakemesinde Beden Muayenesi, Genetik İncelemeler ve Fizik Kimliğin Tespiti Hakkında Yönetmelik  Madde 1- Bu Yönetmelik; bir suça ilişkin iz, eser, emare ve delillerin elde edilmesi; ayrıca, maddî gerçeğin ortaya çıkartılması bakımından şüpheli, sanık, mağdur ve diğer kişilerin beden muayenelerinin yapılması, tıbbî incelemelerde bulunmak üzere vücuttan, kan, cinsel salgı, saç, tükürük, tırnak gibi örneklerin alınması, moleküler genetik incelemeler ile şüpheli ve sanığın kimliğinin teşhisi için gerekli fizikî özelliklerin tespitine ilişkin usul ve esasları düzenlemektir.  Dayanak  Madde 2- Bu Yönetmelik, 04/12/2004 tarihli ve 5271 sayılı Ceza Muhakemesi Kanununun 82 nci maddesine dayanılarak hazırlanmıştır.

59 Şüpheli veya sanığın beden muayenesi  Madde 4- Bir suça ilişkin delil elde etmek için, şüpheli veya sanığın bedeninin tıbbî muayenesine Cumhuriyet savcısı veya mağdurun istemiyle ya da re’sen hâkim veya mahkeme tarafından karar verilebilir.  Şüpheli veya sanığın beden muayenesi ancak hekim tarafından yapılır.  Tıbbî muayenenin yapılabilmesi için; müdahalenin, kişinin sağlığına açıkça ve öngörülebilir zarar verme tehlikesinin bulunmaması gerekir.  Üst sınırı iki yıldan daha az hapis cezasını gerektiren suçlarda kişi üzerinde beden muayenesi yapılamaz

60  Şüpheli veya sanığın vücudundan örnek alınması  Madde 5- Bir suça ilişkin delil elde etmek için, şüpheli veya sanığın vücudundan kan veya cinsel salgı gibi örnekler alınmasına, Cumhuriyet savcısı veya mağdurun istemiyle ya da re’sen hâkim veya mahkeme tarafından karar verilebilir.  Şüpheli veya sanığın vücudundan saç, tükürük ve tırnak gibi örnekler alınabilmesine Cumhuriyet savcısı da karar verebilir. Cumhuriyet savcısının kararı, yirmidört saat içinde hâkim veya mahkemenin onayına sunulur. Hâkim veya mahkeme, yirmidört saat içinde kararını verir. Onaylanmayan kararlar hükümsüz kalır ve elde edilen deliller kullanılamaz. Bu örnekler Cumhuriyet savcısının huzurunda ve uygun göreceği usullerle derhâl yok edilerek bu husus tutanağa geçirilir.  Bu müdahaleler ancak hekim tarafından veya hekim gözetiminde sağlık mesleği mensubu diğer bir kişi tarafından yapılabilir.  Vücuttan örnekler alınabilmesi için; müdahalenin, kişinin sağlığına açıkça ve öngörülebilir zarar verme tehlikesinin bulunmaması gerekir.  Tıbbî müdahaleler, hekimlik sanatının ve tıp biliminin kabul ettiği yöntem ve araçlarla yapılır.  Üst sınırı iki yıldan daha az hapis cezasını gerektiren suçlarda; kişiden kan, saç, tükürük, tırnak, cinsel salgı gibi örnekler alınamaz

61  Diğer kişilerin beden muayenesi Madde 6  Diğer kişilerin vücudundan örnek alınması Madde 7  Soy bağının araştırılması Madde 8 Çocuğun soy bağının araştırılmasına gerek duyulması hâlinde, bu araştırmanın yapılabilmesi için, bu Yönetmeliğin 6 ve 7 nci maddeleri hükümlerine göre karar alınması gereklidir

62  Tanıklıktan çekinme sebeplerinin varlığı  Madde 9- Tanıklıktan çekinme sebepleri ile muayeneden veya bedenden örnek alınmasından kaçınılabilir.  Tanıklıktan çekinme sebeplerinin belirlenmesi hususunda Ceza Muhakemesi Kanununun ilgili hükümleri uygulanır.  Çocuk ve akıl hastasının çekinmesi konusunda kanunî temsilcisi karar verir. Çocuk veya akıl hastasının, tanıklığın hukukî anlam ve sonuçlarını algılayabilecek durumda olması hâlinde, görüşü de alınır.  Kanunî temsilci de şüpheli veya sanık ise bu konuda hâkim tarafından karar verilir. Ancak, bu hâlde elde edilen deliller davanın ileri aşamalarında şüpheli veya sanık olmayan kanunî temsilcinin izni olmadıkça kullanılamaz.

63  Kadının muayenesi  Madde 10- Kadının muayenesi, istemi hâlinde ve olanaklar elverdiğinde bir kadın hekim tarafından yapılır.  Muayene edilecek kadının talebine rağmen bir kadın hekimin bulunmasına olanakların elvermediği durumlarda; muayene sırasında hekim ile birlikte bir başka kadın sağlık mesleği personelinin bulundurulmasına özen gösterilir

64  Moleküler genetik incelemeler  Madde 11- Bu Yönetmelikte öngörülen işlemlerle elde edilen örnekler üzerinde, soy bağının veya elde edilen bulgunun şüpheli veya sanığa ya da mağdura ait olup olmadığının tespiti için zorunlu olması hâlinde moleküler genetik incelemeler yapılabilir. Alınan örnekler üzerinde bu amaçlar dışında tespitler yapılmasına yönelik incelemeler yasaktır.  Birinci fıkra uyarınca yapılabilen incelemeler, bulunan ve kime ait olduğu belli olmayan beden parçaları üzerinde de yapılabilir. Birinci fıkranın ikinci cümlesi, bu hâlde de uygulanır.

65  Bilirkişi incelemesi  Madde 12- Bu Yönetmeliğin 11 inci maddesi hükümleri uyarınca moleküler genetik incelemeler yapılmasına sadece hâkim karar verebilir. Kararda inceleme ile görevlendirilen bilirkişi de gösterilir.  Bilirkişi gerçek ya da tüzel kişi olabilir.  Yapılacak incelemeler için resmen atanan veya bilirkişilikle yükümlü olan ya da soruşturma veya kovuşturmayı yürüten makama mensup olmayan veya bu makamın soruşturma veya kovuşturmayı yürüten dairesinden teşkilât yapısı itibarıyla ve objektif olarak ayrı bir birimine mensup olan görevliler, bilirkişi olarak görevlendirilebilirler. Bu kişiler, teknik ve teşkilât bakımından uygun tedbirlerle yasak moleküler genetik incelemelerin yapılmasını ve yetkisiz üçüncü kişilerin bilgi edinmesini önlemekle yükümlüdürler. İncelenecek bulgu, bilirkişiye ilgilinin adı ve soyadı, adresi, doğum tarihi bildirilmeksizin verilir.

66  Bilirkişiye gönderilen örneklerle ilgili olarak; hâkimlikler, mahkemeler ve Cumhuriyet başsavcılıkları gizliliği sağlamak ve karışıklığa yer vermemek için gerekli her türlü tedbiri alırlar. Bu amaçla güvenli ve gizli bir kayıt sistemi belirlenir. Bu kayıt sisteminde bedeninden örnek alınan kişinin adı, soyadı, adresi ve doğum tarihine karşılık gelmek üzere bir kod sistemi uygulanır.  Üçüncü fıkranın uygulanması açısından, teşkilât yapısı itibarıyla Üniversiteler, Emniyet Genel Müdürlüğü, Jandarma Genel Komutanlığı ve Adlî Tıp Kurumu objektif olarak ayrı birimler sayılırlar

67  Moleküler genetik inceleme sonuçlarının gizliliği  Madde 13- Bu Yönetmelik hükümlerine göre alınan örnekler üzerinde yapılan inceleme sonuçları, kişisel veri niteliğinde olup, başka bir amaçla kullanılamaz; dosya içeriğini öğrenme yetkisine sahip bulunan kişiler tarafından bir başkasına verilemez.  Tüm bu bilgiler, kovuşturmaya yer olmadığı kararına itiraz süresinin dolması, itirazın reddi veya hükmün kesinleşmesi hâllerinde en geç on gün içinde Cumhuriyet savcısının huzurunda ve uygun göreceği usullerle yok edilir ve bu husus dosyasında muhafaza edilmek üzere tutanağa geçirilir. Olay yerinden elde edilen diğer delillere ilişkin hükümler saklıdır.  Bilirkişi tarafından yapılan analizler sonucu elde edilen bulgular ilgili makama gönderilir; bulgular üzerinden moleküler genetik analizler için izole edilen DNA örnekleri bilirkişi tarafından rapor hazırlandıktan sonra imha edilir ve bu husus raporda açıkça belirtilir.  Moleküler genetik incelemelerin özel kalıtsal karakterler hakkındaki açıklamayı içermediği bilinen kromozom bölgesi ile sınırlı kalmasına özen gösterilir.

68  Fizik kimliğin tespiti  Madde 14- Üst sınırı iki yıl veya daha fazla hapis cezasını gerektiren bir suçtan dolayı şüpheli veya sanığın, kimliğinin teşhisi için gerekli olması hâlinde, Cumhuriyet savcısı veya hâkim kararıyla; fotoğrafı, iris görüntüsü, beden ölçüleri, diş izi, parmak ve ayak izi, bedeninde yer almış olup teşhisini kolaylaştıracak eşkâl bilgileri, avuç, kulak, dudak gibi organların bıraktığı kimlik tespitine yarayabilecek vücut izleri ile sesi ve görüntüleri, fizik kimliğin tespitinde kullanılan diğer teknik yöntemler ile kayda alınarak, soruşturma ve kovuşturma işlemlerine ilişkin dosyaya konulur.  Madde 14- Üst sınırı iki yıl veya daha fazla hapis cezasını gerektiren bir suçtan dolayı şüpheli veya sanığın, kimliğinin teşhisi için gerekli olması hâlinde, Cumhuriyet savcısı veya hâkim kararıyla; fotoğrafı, iris görüntüsü, beden ölçüleri, diş izi, parmak ve ayak izi, bedeninde yer almış olup teşhisini kolaylaştıracak eşkâl bilgileri, avuç, kulak, dudak gibi organların bıraktığı kimlik tespitine yarayabilecek vücut izleri ile sesi ve görüntüleri, fizik kimliğin tespitinde kullanılan diğer teknik yöntemler ile kayda alınarak, soruşturma ve kovuşturma işlemlerine ilişkin dosyaya konulur.  Fizik kimliğin tespitinde, öncelikli olarak elin iç yüzeyindeki derinin özel kıvrımlı şekilleri olan parmak ve avuç izleri, fotoğrafı ve eşkâl bilgileri kullanılır. Bu işlemler olay yeri inceleme ve kimlik tespit konusunda özel eğitim almış uzman kolluk mensubu tarafından yapılır.  Fizik kimliğin tespiti açısından, kişinin ağzındaki dişlerin incelenmesi ve diş izlerinin alınması diş hekimi tarafından yapılır

69  Verilerin imhası Madde 15- Kovuşturmaya yer olmadığı veya beraat kararı verilmesi hâlinde bu Yönetmeliğin 14 üncü maddesi hükümleri uyarınca elde edilen veriler, Cumhuriyet savcısının huzurunda ve uygun göreceği usullerle derhâl yok edilir ve bu husus tutanağa geçirilir.  Verilerin korunması Madde 16- Mahkûmiyet kararı verilmesi hâlinde bu Yönetmeliğin 14 üncü maddesinin bir ve ikinci fıkraları uyarınca elde edilen veriler kolluk tarafından, üçüncü fıkrasında belirtilen diş izleri ise bu işlemi yapan sağlık kuruluşu tarafından arşivlenir

70  İlgilinin rızası  Madde 17- Mevzuatta aranan tüm koşulların gerçekleşmiş olmasına ve şüpheli, sanık veya diğer kişilerin bu konuda aydınlatılmış olmalarına rağmen muayene yapılmasına ya da örnek alınmasına rıza vermemeleri hâlinde, kararın infazı için ilgilinin muayenesini veya vücudundan örnek alınmasını sağlamak üzere ilgili Cumhuriyet başsavcılığınca gerekli önlemler alınır.  Bir suçun aydınlatılmasını sağlamak amacıyla, şüpheli, sanık ve diğer kişilerin kendiliğinden başvurarak rıza göstermeleri hâlinde, soruşturma evresinde Cumhuriyet savcısının istemi, kovuşturma aşamasında ise hâkim veya mahkeme kararıyla tıbbî muayeneleri yapılabilir ya da vücutlarından örnek alınabilir

71  Tedavi amaçlı müdahaleler Madde 18- Sağlık mevzuatı ve taraf olunan uluslararası sözleşmeler uyarınca hekim tarafından yapılması gereken tedavi amaçlı tıbbî muayene ve müdahaleler için Cumhuriyet savcısı ya da hâkim kararı aranmaz.  Gecikmesinde sakınca bulunan hâller Madde 19  Raporların düzenlenmesi Madde 20 Hekim raporları üç nüsha hâlinde düzenlenir. Raporu düzenleyen sağlık kuruluşunca iki nüshası kapalı ve mühürlü zarf içerisinde ilgili Cumhuriyet başsavcılığına, hâkimliğe veya mahkemeye en seri şekilde iletilir. Raporun bir nüshası raporu düzenleyen sağlık kuruluşunda kalır.

72  Güvenlik önlemleri  Madde 21- Muayene edilmesi veya vücudundan örnek alınması amacıyla sevk edilen kişi dışında başka bir kişinin muayene edilmemesi ya da vücudundan örnek alınmaması için Cumhuriyet başsavcılıklarınca gerekli önlemler alınır.  Hekim veya diğer sağlık mesleği mensuplarınca, sevk edilen kişinin kimliği konusunda şüpheye düşülmesi hâlinde durum derhâl Cumhuriyet başsavcılığına bildirilir.  Alınan, muhafaza edilen, nakledilen ve incelenen örneklerin değiştirilmemesi ve dış koşullardan etkilenip bozulmaması için Cumhuriyet başsavcılığı, kolluk, sağlık kuruluşu ve bilirkişi tarafından gerekli tedbirlere başvurulur.

73  Verilerle ilgili işlemler Madde 22  Diğer İşlemler Madde 23- Kişinin vücut yüzeyinde bulunan atış artığı gibi biyolojik olmayan örnekler, elbiseleri ve diğer eşyaları üzerinde bulunan örnekler ile vücut yüzeyinden başkasına ait olduğu açıkça belli olan kıl, tüy, lif gibi örnekler olay yeri inceleme uzmanları tarafından alınabilir.  İtiraz Madde 24  Yürürlük Madde 25  Yürütme Madde 26

74 Teşekkürler…

75 Fundamental Approaches


"DNA TİPLEMESİNİN ADLİ TIBBİ UYGULAMALARI FORENSIC DNA Ref: Dr.Oğuzhan Ekizoğlu İstanbul Tıp Fakültesi Adli Tıp Ana Bilim Dalı Yrd.Doç.Dr. Alper Tunga Akarsubaşı." indir ppt

Benzer bir sunumlar


Google Reklamları