Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

Mutasyon Analiz Teknikleri I Doç. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları.

Benzer bir sunumlar


... konulu sunumlar: "Mutasyon Analiz Teknikleri I Doç. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları."— Sunum transkripti:

1 Mutasyon Analiz Teknikleri I Doç. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları

2 DHPLC Transgenomic/ WAVE http://www.transgenomic.com/flash/DHPLCFlash2.asp

3 DHPLC http://insertion.stanford.edu/melt.html BRCA ex1 CAATAGGTAGCGATTCTGACCTTCGTACAGCAATTACTGTGATGCAATAA GCCGCAACTGGAAGAGTAGAGGCTAGAGGGCAGGCACTTTATGGCAAACT CAGGTAGAATTCTTCCTCTTCCGTCTCTTTCCTTTTACGTCATCCGGGGG CAGACTGGGTGGCCAATCCAGAGCCCCGAGAGACGCTTGGCTCTTTCTGT CCCTCCCATCCTCTGATTGTACCTTGATTTCGTATTCTGAGAGGCTGCTG CTTAGCGGTAGCCCCTTGGTTTCCGTGGCAACGGAAAAGCGCGGGAATTA CAGATAAATTAAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCT GGACGGGGGACAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTC AGGAGGCCTTCACCCTCTGCTCTGGGTAAAGGTAGTAGAGTCCCGGGAAA GGGACAGGGGGCCCAAGTGATGCTCTGGGGTACTGGCGTGGGAGAGTGGA TTTCCGAAGCTGACAGATGGGTATTCTTTGACGGGGGGTAGGGGCGGAAC CTGAGAGGCGTAAGGCGTTGTGAACCCTGGGGAGGGGGGCAGTTTGTAGG TCGCGAGGGAAGCGCTGAGGATCAGGAAGGGGGCACTGAGTGTCCGTGGG GGAATCCTCGTGATAGGAACTGGAATATGCCTTGAGGGGGACACTATGTC TTTAAAAACGTCGGCTGGTCATGAGGTCAGGAGTTCCAGACCAGCCTGAC CAACGTGGTGAAACTCCGTCTCTACTAAAAATACAAAAATTAGCCGGGCG TGGTGCCGCTCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTAGAAC C with 851 base pairs Melting temperature of entire strand: 61.25° Temperature = 55° Celsius: 1-3, Temperature = 56° Celsius: 4-5, Temperature = 57° Celsius: 777-789, Temperature = 58° Celsius: 6-6,776-776,790-791, Temperature = 59° Celsius: 7-48,302-312,773-775,792-792, Temperature = 60° Celsius: 49-138,297-301,313-314,771-772, Temperature = 61° Celsius: 139-296,315-316,654-770,793-851 Temperature = 62° Celsius: 317-653, This sequence should be run at all of the following temperatures to ensure detection of all polymorphisms. Recommended temperature: 62° Recommended temperature: 56°

4 DHPLC CBP Exon 6 A. Rothan’dan

5 DHPLC A. Rothan’dan

6 DHPLC A. Rothan’dan

7 DHPLC Ezzeldin et al. Ann Biochem. 2002;306:63-73.

8 DHPLC

9 DHPLC = denaturing high-performance liquid chromatography. Ezzeldin et al. Ann Biochem. 2002;306:63-73.

10 Karıştırma testi DHPLC P300/EXON16 4239G->T E1014X

11 CBP/EXON31.1 5371-8INSA Karıştırma testi DHPLC

12 DHPLC HDAC2 EXON1 Karıştırma

13 HDAC2 143InsCAG

14 DHPLC HDAC2 EXON12 Karıştırma

15 HDAC2 1573DelA HCT15

16 SSCP HSUV39H2 -11InsA (?)

17 Kapiller Elektroforez

18 Genel Primerlerle işaretleme

19 P300 4239G>T (E1014X)

20

21 CBP IVS21-4del22

22

23 CBP IVS31-7InsA

24

25 TGCE Temperature Gradient Capillary Electrophoresis http://www.spectrumedix.com/7144_9155163437/blank/browse.asp?a =383&BMDRN=2000&BCOB=0&c=53494


"Mutasyon Analiz Teknikleri I Doç. Dr. Hilâl Özdağ Hafta VII PCR Temelli Genetik Analiz Yaklaşımları." indir ppt

Benzer bir sunumlar


Google Reklamları