Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

İRLANDA DUBLİNDE BİR 3. BASAMAK HASTANEDEN İZOLE EDİLEN KLEBSİELLA PNEUMONIAE İZOLATLARININ PLAZMİDİK AMP C B-LAKTAMAZLARININ SAPTANMASI VE MOLEKÜLER TİPLENDİRİLMESİ.

Benzer bir sunumlar


... konulu sunumlar: "İRLANDA DUBLİNDE BİR 3. BASAMAK HASTANEDEN İZOLE EDİLEN KLEBSİELLA PNEUMONIAE İZOLATLARININ PLAZMİDİK AMP C B-LAKTAMAZLARININ SAPTANMASI VE MOLEKÜLER TİPLENDİRİLMESİ."— Sunum transkripti:

1 İRLANDA DUBLİNDE BİR 3. BASAMAK HASTANEDEN İZOLE EDİLEN KLEBSİELLA PNEUMONIAE İZOLATLARININ PLAZMİDİK AMP C B-LAKTAMAZLARININ SAPTANMASI VE MOLEKÜLER TİPLENDİRİLMESİ Araş.Gör.Dr. Fatma Esenkaya Taşbent Yrd. Doç Dr. Mehmet ÖZDEMİR

2 Detectıon and molecular characterısatıon of plasmıdıc Amp C B-lactamases ın Klebsiella pneumoniae isalates from a tertiary-care hospıtal in Dublin,Ireland 2008 European Society of Clinical Microbiology and Infectious Diseases Detectıon and molecular characterısatıon of plasmıdıc Amp C B-lactamases ın Klebsiella pneumoniae isalates from a tertiary-care hospıtal in Dublin,Ireland 2008 European Society of Clinical Microbiology and Infectious Diseases

3 Dünya genelinde Klebsiella p n eu moniae izolatları arasındaki Amp C B-laktamazlar gittikçe artmaktadır Dünya genelinde Klebsiella p n eu moniae izolatları arasındaki Amp C B-laktamazlar gittikçe artmaktadır

4 Bununla birlikte dirençli Klebsiella p n eu moniae izlolatları arasından Amp C tipi B-laktmazların prevelansı, Amerika da % 8,5 den İngilterede % 55 e kadar bölgesel olarak farklılık göstermektedir Bununla birlikte dirençli Klebsiella p n eu moniae izlolatları arasından Amp C tipi B-laktmazların prevelansı, Amerika da % 8,5 den İngilterede % 55 e kadar bölgesel olarak farklılık göstermektedir

5 İrlanda’daki Klebsiella p n eu moniae Amp C enzimlerinin epidemiyolojisi ve tiplendirilmesi hakkında sınırlı miktarda bilgi var İrlanda’daki Klebsiella p n eu moniae Amp C enzimlerinin epidemiyolojisi ve tiplendirilmesi hakkında sınırlı miktarda bilgi var

6 Bu prospektif çalışma plazmid ile ilişkili Amp C B- laktamazları taşıyan Klebsiella p n eu moniae izolatlarının epidemiyolojisini belirlediği gibi 3. kuşak sefalosporinlere dirençli Klebsiella p n eu moniae izolatları arasındaki Amp C enziminin tipini ve prevelansını da belirlemiştir Bu prospektif çalışma plazmid ile ilişkili Amp C B- laktamazları taşıyan Klebsiella p n eu moniae izolatlarının epidemiyolojisini belirlediği gibi 3. kuşak sefalosporinlere dirençli Klebsiella p n eu moniae izolatları arasındaki Amp C enziminin tipini ve prevelansını da belirlemiştir

7 Seftazidim, sefotaksim ve/veya sefpodoksim gibi 3. kuşak sefalosporinlerin bir yada daha fazlasına dirençli replike olmamış Klebsiella p n eu moniae izolatları Nisan 2005 den Mart 2007 ye kadar prospektif olarak toplanmıştır Seftazidim, sefotaksim ve/veya sefpodoksim gibi 3. kuşak sefalosporinlerin bir yada daha fazlasına dirençli replike olmamış Klebsiella p n eu moniae izolatları Nisan 2005 den Mart 2007 ye kadar prospektif olarak toplanmıştır

8 Duyarlılıkları CLSI kriterlerine göre disk difüzyon, E test, agar dilüsyon ve VITEC 2 duyarlılık test sistemi kullanılarak belirlendi Duyarlılıkları CLSI kriterlerine göre disk difüzyon, E test, agar dilüsyon ve VITEC 2 duyarlılık test sistemi kullanılarak belirlendi İzolatların identifikasyonu VITEC identifikasyon sistemine göre yapıldı İzolatların identifikasyonu VITEC identifikasyon sistemine göre yapıldı

9 Amp C B- laktamaz taraması E test ve VITEC 2 ile sefotaksim ve seftazidim MIC lerini ölç ü lerek ve 100 mg/L kloksasilin içeren ve içermeyen Müller Hinton Medyum kullanılarak yapılmıştır Amp C B- laktamaz taraması E test ve VITEC 2 ile sefotaksim ve seftazidim MIC lerini ölç ü lerek ve 100 mg/L kloksasilin içeren ve içermeyen Müller Hinton Medyum kullanılarak yapılmıştır Kloksasilin varlığında MIC deki iki kat veya daha fazla azalma Amp C B-laktamaz varlığını göstermektedir Kloksasilin varlığında MIC deki iki kat veya daha fazla azalma Amp C B-laktamaz varlığını göstermektedir

10 Sefoksitin 30 mg diskinin yanındaki sefotaksim 30 mg yanındaki zonda birleşme Amp C indüksiyonunu n tespitinde problem oluşturmaktadır Sefoksitin 30 mg diskinin yanındaki sefotaksim 30 mg yanındaki zonda birleşme Amp C indüksiyonunu n tespitinde problem oluşturmaktadır

11 .. Amp C enzimini kodlayan genler Multiplex PCR kullanılarak identifiye edildi. Ardışık PCR ve sekanslama acc geni için Amp C enzimini kodlayan genler Multiplex PCR kullanılarak identifiye edildi. Ardışık PCR ve sekanslama acc geni için 5 – TTTTCTTTTGCATGCGGATT ve 5 – TTTTCTTTTGCATGCGGATT ve 5 – ACAGGGCGTGCTGTAATACC primerlerini, dha geni için 5- ACACTGATTTCCGCTCTGCT ve 5 – ACAGGGCGTGCTGTAATACC primerlerini, dha geni için 5- ACACTGATTTCCGCTCTGCT ve 5- ACAATCGCCACCTGTTTTTC primerlerini kullanarak oluşturulmuştur 5- ACAATCGCCACCTGTTTTTC primerlerini kullanarak oluşturulmuştur

12 Dha 1 geninin üzerindeki Amp R geninin saptanması için kullanılan primer Dha 1 geninin üzerindeki Amp R geninin saptanması için kullanılan primer 5 -CAGGGTAAAGCGGTGAACAT dır. Bu çalışmada bildirilen nükleotid sekansları şu numaralar altında (acc-1 için EF ve Amp R ve dha 1 için EF633612) gen bankasında bulunmaktadır 5 -CAGGGTAAAGCGGTGAACAT dır. Bu çalışmada bildirilen nükleotid sekansları şu numaralar altında (acc-1 için EF ve Amp R ve dha 1 için EF633612) gen bankasında bulunmaktadır İntegron analizleri Levesque ve arkadaşların ın tarifine göre yapılmıştır. B akteriyel DNA nın lizisi sonrası CHEF DR II sistemi kullanılarak pulsed field gel elektroforez ile izolatlar genotiplendirilmiştir İntegron analizleri Levesque ve arkadaşların ın tarifine göre yapılmıştır. B akteriyel DNA nın lizisi sonrası CHEF DR II sistemi kullanılarak pulsed field gel elektroforez ile izolatlar genotiplendirilmiştir

13

14 İzolatlar arasındaki ilişki aritmetik ortalama ile eşleşmiş grup yöntemi kullanılarak küme analizleri yapılarak Dice Coefficient kullanıla r ak hesaplanmıştır İzolatlar arasındaki ilişki aritmetik ortalama ile eşleşmiş grup yöntemi kullanılarak küme analizleri yapılarak Dice Coefficient kullanıla r ak hesaplanmıştır 500 K.p n eu monia e klinik izolat ı ndan 32 sinde en az bir oksiimino B-laktama artmış direnç gösterildi 500 K.p n eu monia e klinik izolat ı ndan 32 sinde en az bir oksiimino B-laktama artmış direnç gösterildi

15 Bu izolatların 15 i (%48i) m uhtemel Amp C üreten bakteri olarak seçildi. Bir izolat fenotipik testlere göre klas A tipi ESBL üretmiştir. Geri kalan 17 izolat da, ESBL üreten Klas A fenotipine sahipti Bu izolatların 15 i (%48i) m uhtemel Amp C üreten bakteri olarak seçildi. Bir izolat fenotipik testlere göre klas A tipi ESBL üretmiştir. Geri kalan 17 izolat da, ESBL üreten Klas A fenotipine sahipti 15 seçilmiş izolatın Multiplex PCR la Amp C + olduğu gösterilmiş olup bunlardan 13 ü acc tipi B laktamaz, 2 si ise dha tipi B-laktamaz olduğu tespit edildi 15 seçilmiş izolatın Multiplex PCR la Amp C + olduğu gösterilmiş olup bunlardan 13 ü acc tipi B laktamaz, 2 si ise dha tipi B-laktamaz olduğu tespit edildi 2 izolattan sonuncusunda indüklenebilir direnç bulundu. 2 izolattan sonuncusunda indüklenebilir direnç bulundu.

16 Nükleotid sekanslama sonucu 13 bla acc geni daha önce gen bankasına girişi yapılan Klebsiella p n eu monia e bla acc-1 sekansı ile % 100 uyumlu bulundu Nükleotid sekanslama sonucu 13 bla acc geni daha önce gen bankasına girişi yapılan Klebsiella p n eu monia e bla acc-1 sekansı ile % 100 uyumlu bulundu İki bla dha gen sekansı da identifiye edildi ve bilinen Klebsiella pneumoniae bla dha 1 geni ile %100 uyuma sahipti İki bla dha gen sekansı da identifiye edildi ve bilinen Klebsiella pneumoniae bla dha 1 geni ile %100 uyuma sahipti

17 Ek olarak bla dha 1 gen izolatlarının her ikisinde de Amp R bulundu. PCR sonuçlarına göre dha 1 olan iki izolat ve acc 1 olan bir izolat pozitif olarak izlendi Ek olarak bla dha 1 gen izolatlarının her ikisinde de Amp R bulundu. PCR sonuçlarına göre dha 1 olan iki izolat ve acc 1 olan bir izolat pozitif olarak izlendi 15 izolatın hepsi karbapenemlere ve sefepime duyarlı idi. Yüksek düzeyde sefoksiti n direnci, yalnızca dha 1 üreten 2 izolatta bulundu. 15 izolatın hepsi amoksilin/klavulonik aside dirençli idi. 15 izolatın hepsi karbapenemlere ve sefepime duyarlı idi. Yüksek düzeyde sefoksiti n direnci, yalnızca dha 1 üreten 2 izolatta bulundu. 15 izolatın hepsi amoksilin/klavulonik aside dirençli idi. Ama en çok duyarlılık amikasin, gentamisin ve siprofloksasine karşı bulundu Ama en çok duyarlılık amikasin, gentamisin ve siprofloksasine karşı bulundu

18 Acc 1 üreten 13 izolatın küme analizinde birbirleri ile farklı ilişki düzeyindeki izolatlardan 3 küme oluşturulması düşünüldü Acc 1 üreten 13 izolatın küme analizinde birbirleri ile farklı ilişki düzeyindeki izolatlardan 3 küme oluşturulması düşünüldü Küme 1; bant farklılığı içermeyen 2 tip izolat (7 ve 9) Küme 2; 4 band faklılığı içeren iki izolat (6 ve 14) ve Küme 3; altı band farklılığı içeren 2 izolattan oluşmaktadır Küme 1; bant farklılığı içermeyen 2 tip izolat (7 ve 9) Küme 2; 4 band faklılığı içeren iki izolat (6 ve 14) ve Küme 3; altı band farklılığı içeren 2 izolattan oluşmaktadır Bu üç küme birbiriyle ilişkili değildi Bu üç küme birbiriyle ilişkili değildi Geri kalan izolatlar tamamen birbirinden farklı idi. Geri kalan izolatlar tamamen birbirinden farklı idi.

19 Son uç olarak bu çalışma acc1 ve dha1 içeren iki tip plazmidik Amp C enzimini identifiye etmiştir. Son uç olarak bu çalışma acc1 ve dha1 içeren iki tip plazmidik Amp C enzimini identifiye etmiştir. İrlandadaki Dha 1 üreten plazmidik indüklenebilir Amp C enzim i bulunduran iki izolat ilk defa bildiri lirken major kazanılmış Amp C enzimi acc 1 di İrlandadaki Dha 1 üreten plazmidik indüklenebilir Amp C enzim i bulunduran iki izolat ilk defa bildiri lirken major kazanılmış Amp C enzimi acc 1 di Bu enzim Klebsiella pneumoniae izolatlarının % 48 den identifiye edildi. Bu enzim Klebsiella pneumoniae izolatlarının % 48 den identifiye edildi.

20 Bu oran benzer seleksiyon kriterleri ile, İrlanda ve İngilterede yapılan bir yeni çalışmadaki % 25 lik sıklığa benzemektedir Bu oran benzer seleksiyon kriterleri ile, İrlanda ve İngilterede yapılan bir yeni çalışmadaki % 25 lik sıklığa benzemektedir Avrupa içinde yayılan acc 1 geniyle ilgili Fransa ve İspanyadan yapılan diğer bildirimler de benzer sonuçlar içermekteydi Avrupa içinde yayılan acc 1 geniyle ilgili Fransa ve İspanyadan yapılan diğer bildirimler de benzer sonuçlar içermekteydi Acc üreten Klebsiella pneumoniae izolatlarının çoğu sefoksitine duyarlı idi Acc üreten Klebsiella pneumoniae izolatlarının çoğu sefoksitine duyarlı idi

21 Farklı olarak, sefoksitin dirençli ise oksiimino B- laktamlara azalmış duyarlılık klas c B-laktamaz üretimini gösterir Farklı olarak, sefoksitin dirençli ise oksiimino B- laktamlara azalmış duyarlılık klas c B-laktamaz üretimini gösterir Klebsiella pneumoniae izolatları sefoksitin ve sefepime duyarlıdır Klebsiella pneumoniae izolatları sefoksitin ve sefepime duyarlıdır Fakat seftazidim ve sefotaksime duyarlılık azalmıştır Fakat seftazidim ve sefotaksime duyarlılık azalmıştır

22 Bu durum plazmidik Amp C üretimi ile ilgili olabilir bu nedenle diğer testlerle konfirme edilmelidir. Bu durum plazmidik Amp C üretimi ile ilgili olabilir bu nedenle diğer testlerle konfirme edilmelidir. Pulsed field jel elektroforezi, hastane içinde transfer edilebilir Amp C ilişkili direncin insidansını, tek bir klonun yayılımından ziyade mobil bir elementin transferi sonucu olduğunu belirtmektedir. Pulsed field jel elektroforezi, hastane içinde transfer edilebilir Amp C ilişkili direncin insidansını, tek bir klonun yayılımından ziyade mobil bir elementin transferi sonucu olduğunu belirtmektedir. İrlandadaki bu enzimlerin prevelansının ve ortaya çıkışının surveyansı gereklidir İrlandadaki bu enzimlerin prevelansının ve ortaya çıkışının surveyansı gereklidir

23 TEŞEKKÜRLER


"İRLANDA DUBLİNDE BİR 3. BASAMAK HASTANEDEN İZOLE EDİLEN KLEBSİELLA PNEUMONIAE İZOLATLARININ PLAZMİDİK AMP C B-LAKTAMAZLARININ SAPTANMASI VE MOLEKÜLER TİPLENDİRİLMESİ." indir ppt

Benzer bir sunumlar


Google Reklamları