Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ

Benzer bir sunumlar


... konulu sunumlar: "HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ"— Sunum transkripti:

1 HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ
Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı

2 Hemoglobin A Molekülünün Yapısı

3 Eritrosit Yapısı Çapı 6.0-9.0 µm Kalınlığı merkezde 1 µm
Kenarlarda µm Membran kalınlığı 6.0 nm

4 Erişkin bir insan kanında
HbA (2α2β) %96 HbA2 (2α2) % 3 HbF (2α2γ) % 1

5 Hemoglobin Oksijen ve 2,3 DFG molekülü

6 Normal insan hemoglobinleri
Embriyonik Hemoglobinler Fetal Hemoglobin Erişkin Hemoglobinleri Hb Gower 1 (ζ2ε2) Hb F (α2γ2) Hb A (α2β2) Hb Gower 2 (α2ε2 ) Hb A2 (α2δ2) Hb Portland (ζ2γ2)

7 Alfa ve beta benzer globin gen kümeleri

8 Hb molekülü için alfa ve beta globin genlerinin zincir üretimi

9

10

11

12

13

14

15

16

17

18

19 GAG T g a

20 HbA Molekülü ve HbS taşıyıcılığı
HbAS (2αβAβS) HbSS (2α2βS)

21

22

23 Beta talasemi taşıyıcısı
HbA (2α2β) HbA2 (2α2)  HbA2 <%3.7 MCV<78

24 Hematolojik Değerler Normal Sınırlar Bulunan Değer RBC 1012 /L 4,10-5,10 Hb g/dL 12,3-15,3 Hct % 36,0-45,0 MCV fL 80,0-96,1 MCH pg 27,5-33,2 MCHC g/dL 33,4-35,2 Hb Elektroforezi HbAA Hb A2 % 2,5-3,5 Hb F % <1,0 Hb S % 35,0-45,0

25 HPLC ile belirlenen HbAX

26 Taşıyıcıların belirlenmesi
Kan örneği alınır EDTA*Na2 tüplere konur Bu kan örneğinden sayım yapılır Hemoglobin varyant analizi yapılır Anormal Hb, beta veya alfa talasemi tanısı alır Bu kandaki lökositlereden DNA izole edilir PCR ile mutasyon taraması yapılır Doğum öncesi tanıda CVS de bu mutasyonlar aranır

27 Prenatal tnı için CVS Alınması

28 RFLP ve ARMS sonuçları A B CVS AA AS SS A B CVS SS

29 Alfa talasemi taşıyıcısı
HbA (2α2β) HbA2 (2α2) HbA2 <%3.5 HbH (β4)

30 30

31 TTCTGTAG ACACCGTGCTGACCT CCAAATA
GTGCA CGCCTCCCTGGACAAGTT CCTGGC TTCTGTAG ACACCGTGCTGACCT CCAAATA CCGTTAAgctggagcctcgg tggccatgcttcttgcccctt gggcctccccccagcccctcctccccttcc tgcacccgtaccccc PolyA gtggtctttaataaagtctgagtgggcggcagccgttgtgtg   g g cctgagtttttt ctgtcccggaatgtgccaacaatgg

32 cvs

33 Delesyonel Alfa Talasemiler

34 ALFA TALASEMİ GENOTİPLERİ
Klinik Durum Gen sayısı Genotip Sağlam / Normal Sessiz taşıyıcı (+) - / -thal-2 heterozigot Homozigot - /- -thal-2 homozigot Ağır Taşıyıcı (0) / -thal-1 heterozigot HbH /-  -thal-1/-thal-2 Bart’s - -/ -thal-1 homozigot Nondelesyonel -talasemi */ Nondelesyonel -thal HbH * / * Non del -thal homozigot HbH / * -thal-1/Non del -thal HbH /  * -thal-1/Non del -thal * Nokta mutasyonu

35 Talasemi ve Hemoglobin Varyantlarının Yeryüzündeki Dağılımı

36 GLOBİN DATABASE’ DE KAYITLI BULUNAN MUTASYON SAYILARI
Alfa1 genini kapsayan giriş 265 Alfa2 genini kapsayan giriş 313 Beta genini kapsayan giriş 735 Delta genini kapsayan giriş 79 AGama genini kapsayan giriş 50 GGama genini kapsayan giriş 56 Total varyant ile talasemi girişi 50 Yüksek oksijen affinitesine sahip Hemoglobinler 91 Unstable hemoglobinler 134 Methemoglobins 9 İnsersiyon mutasyon girişi 53 Füzyon gen mutasyon girişi 8 Delesyon mutasyon girişi 159 Substition mutasyonu girişi 1081 Total globin database giriş 1326

37 HEMOGLOBİNOPATİLER Hemoglobin Varyantları (n:981) Talasemiler (n:395)

38 GLOBİN GEN KOMBİNASYONLARI

39 Hemoglobin Varyantları
Alfa zincir varyantları………………………… 199……………………. 217 Beta zincir varyantları…………………………355………………… ….362 Gama zincir varyantları…………………… … 68……………………… 70 Delta zincir varyantları………………………… 28…………………..…..32 ¡ki amino asitili varyantlar………………… …18…………………..……19 Hibrit zincirli varyantlar……………………… 10……………………. ..10 Uzamış zincir varyantları……………………… 13…………………..……13 Diger varyantlar……………………………………….22…………………..…..27 Toplam ……………………………….…………………693*………………….750**………981*** *Huisman THJ, Carver MFH and Efremov GD:A Syllabus of human hemoglobinvariants. Sickle Cell Anemia Foundation. 1996, Augusta GA. USA **Huisman THJ, Carver MFH and Efremov GD:A Syllabus of human hemoglobinvariants. Sickle Cell Anemia Foundation. 1998, Augusta GA. USA ***http://globin.bx.psu.edu/cgi-bin/hbvar/counter 2008

40 Anormal Hemoglobinler
Hb S  GluVal Hb E  GluLys Hb D  121 GluGln Hb C  GluLys Hb H 4 Hb Barts 4

41 HbS β6 (GAG→GTG); Glu →Val
Oksijen azlığında HbS molekülleri polimerleşir. Eritrositlerin orak şeklini almasına neden olur. Bu olay ile (sickling testi) HbS çok kolay tanımlanır. Homozigot kişilerde orak hücre anemisi ciddi bir sorun olur. Orak hücre taşıyıcıları, hipoksi gibi ekstrem koşullarda oluşan intravasküler sikling dışında herhangi bir klinik bulgu vermez.

42 HbC: 6 (GAG→AAG); GluLys
HbA’dan daha az çözünen HbC, kılcal damarlar içinde eritrositlerin deformasyonunu azaltır. Eritrositler içinde kristalleşme eğilimi gösterir Hafif derecede hemolitik anemiye neden olur. Homozigot HbC hafif seyreden hemolitik anemi ile karakterizedir

43 HbD: 121 (GAG→AAG);GluGln
HbD Taşıyıcılarında klinik hematolojik veya fizyolojik olarak bir anormalik gözlenmez. Homozigot kişilerde orta derecede hemolitik anemi tespit edilmiştir.

44 HbE: 26(GAG→AAG); GluLys
HbE taşıyıcılarında; Kırmızı kan hücrelerinde mikrositoz ve hipokromi ile hafif derecede anemi meydana gelmektedir HbE homozigotlar asemptomatiktir. HbE mutasyonu farklı β-talasemi alleleriyle birlikte anormal fenotip oluşturmaktadır.

45 Ülkemizde Tespit Edilen Hb Varyantları*
İlk kez Türklerde belirlenen varyant sayısı: 8 Alfa zincir varyantları Beta zincir varyantları Gama zincir varyantları Hibrit zincir varyantları Beta zinciri içinde delesyon ve inversiyon Toplam *Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

46 Ülkemizde Tespit Edilmiş Alfa Zincir Varyantları (n:14)*
Hb Adı Rezidü/Değişim Mutasyon O-Padova 30Glu→Lys GAG→AAG Hasharon 47Asp→His GAC→CAC Montgomery 48Leu→Arg CTG→CGG Adana* Gly→Asp GGC→GAC J-Anatolia 61Lys→Thr AAG→ACG Ube Asn→Asp AAC→GAC Q-Iran Asp→His GAC→CAC Moabit Leu→Arg CTG→CGG M-Iwate 87His→Tyr CAC→TAC Çapa* Asp→Gly GAC→GGC G-Georgia 95Pro→Leu CCG→CTG Strumica 112His→Arg CAC→CGC J-Meerut (J-Birmingham) 120Ala→Glu GCG→GAG Costant Spring Amino asit *Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

47 Ülkemizde Tespit Edilmiş Beta Zincir Varyantları (n:24)
Hb Adı Rezidü/Değişim Mutasyon Antalya Leu-Thr-Pro→Ser-Asp-Ser CTGACTGAGTCTGACTCT S 6Glu→Val GAT→GTG C 6Glu→Lys GAG→AAG Ankara* 10Ala→Asp GCC→GAC E-Saskatoon 22Glu→Lys GAA→AAA G-Coushatta 22Glu→Ala GAA→GCA D-Iran 22Glu→Gln GAA→CAA E Glu→Lys GAG→AAG Knossos 27Ala→Ser GCC→TCC Hakkari* 31Leu→Arg CTG→CGG G-Copenhagen 47Asp→Asn GAT→AAT SummerHill 52Asp→His GAT→AAT Hamadan 56Gly→Arg GGC→CGC Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

48 Ülkemizde Tespit Edilmiş Beta Zincir Varyantları (n:24)
Hb Adı Rezidü/Değişim Mutasyon J-Antakya* 65Lys→Met AAG→ATG City of Hope 69Gly→Ser GGT→AGT J-Iran 77His→Asp CAC→GAC G-Szuhu 80Asn→Lys AAC→AAA veya AAG Istanbul /Saint Etienne 92His→Gln CAC→CAA veya CAG N-Batimore 95Lys→Glu AAG→GAG Köln 98Val→Met GTG→ATG Los Angeles (D-Punjab) 121Glu→Gln GAA→CAA O-Arab 121Glu→Lys GAA→AAA Beograd 121Glu→Val GAA→GTA Sarrebourg 131Gln→Arg CAG→CGG Bronckton 138Gln→Arg GCT→CCT Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

49 Ülkemizde Tespit Edilmiş Unstable Zincir Varyantları
Hb Adı Rezidü/Değişim Mutasyon Hasharon α47 Asp→His GAC→CAC Adana α59 Gly→Asp GGC→GAC Moabit α86 Leu→Arg CTG→CGG Çapa α94 Asp→Gly GAC→GGC Hakkari β31 Lue→Arg CTG→CGG İstanbul (St Etienne) β92 His→Gln CAC→CAA veya CAG Köln β98 Val→Met GTG→ATG Constant Spring α142 (+31 aa) TAA→CAA Antalya β3-5Leu-Thr-Pro→Ser-Asp-Ser CTGACTGAGTCTGACTCT Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

50 Hemoglobinopati alt grupları
Hemoglobinopati Türü Hemoglobin Varyantları Alfa Talasemiler Beta Talasemiler Toplam Sayı Dünya (n) Türkiye (n) 1000< < < < 105

51 Bazı Yeni Mutasyon Türleri
Mutasyon Türü ve yeri Hb Adana 1 geni IVS 1 geni Poly A 2 geni IVS  geni Yayınlanan Dergi ve yılı Am J Hematol 1993 Br J Hematol 1993 Br J Hematol 1992 Hemoglobin 1995

52 Çürük MA, Howard SC, Kutlar A, Huisman TH
Çürük MA, Howard SC, Kutlar A, Huisman TH. A newly discovered beta O-thalassemia (IVS-II-850, GA) mutation in a north European family. Hemoglobin May-Jul;19(3-4): Çürük MA, Dimovski AJ, Baysal E, Gu LH, Kutlar F, Molchanova TP, Webber BB, Altay C, Gürgey A, Huisman TH Hb Adana or alpha 2(59)(E8)Gly  Asp beta 2, a severely unstable alpha 1-globin variant, observed in combination with the -(alpha)20.5 Kb alpha-thal-1 deletion in two Turkish patients. Am J Hematol Dec;44(4):270-5. Çürük MA, Baysal E, Gupta RB, Sharma S, Huisman TH. An IVS-I-117 (G A) acceptor splice site mutation in the alpha 1-globin gene is a nondeletional alpha-thalassaemia-2 determinant in an Indian population. Br J Haematol Sep;85(1): Yüregir GT, Aksoy K, Çürük MA, Dikmen N, Fei YJ, Baysal E, Huisman TH. Hb H disease in a Turkish family resulting from the interaction of a deletional alpha-thalassaemia-1 and a newly discovered poly A mutation. Br J Haematol Apr;80(4):527-32

53 ANORMAL HEMOGLOBİNLER
Hb tiplendirmesi Hb elektroforezi İzoelektrofokusing (IEF) High Performance Liquid Chromatography (HPLC)

54 Hb Elektroforezi (-) (+)

55 AE AE AA SE AE SF AS AH AS AS AA AS Hb Elektroforezi AH AH AA

56 İzoelektrofokusing (IEF)

57 IEF Sonuçları

58 High Performance Liquid Chromatography (HPLC)

59 HbS’nin HPLC’de Ayırımı
Hb D’nin HPLC’de Ayırımı

60 HbC’nin HPLC’de Ayırılması
HbE’nin HPLC’de Ayırılması

61 HbAE nin HPLC ile Ayrılması
HbEE-Saskatoon’nun HPLC ile Ayrılması

62 HbS ve HbD Taşıyıcılarına Ait Hematolojik Veriler
Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH Pg MCHC Tipi β-globin Genotipi E-6 4.65 13.7 39.1 84.0 23.6 25.3 AS E-40 5.07 14.4 43.0 84.9 28.4 33.4 E-34 5.19 14.2 41.4 79.6 27.3 34.3 K-33 4.18 10.8 33.6 80.4 25.8 32.0 K-25 4.91 12.4 40.6 82.5 25.2 30.6 E-32 5.69 14.9 46.0 80.8 26.2 32.4 AD K-19 5.70 13.9 44.7 80.9 29.2 31.5 E-27 4.71 14.1 44.5 94.3 29.9 31.7 K-28 4.08 11.4 34.4 84.3 27.9 33.1 E-28 5.40 15.8 47.1 87.2 28.3 3.92 11.7 33.3 84.8 29.8 35.2

63 HbE ve HbC Taşıyıcılarına Ait Hematolojik Veriler
Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH Pg MCHC Elektr. Beta Globin Genotipi K-31 4.66 11.0 33.1 71.1 23.7 33.4 AE K-28 3.85 10.0 30.5 79.1 25.9 32.8 E-37 5.44 13.8 21.5 76.5 25.3 33.3 E-28 4.36 34.0 77.8 25.1 31.8 K-34 4.47 10.7 34.4 77.0 24.0 31.1 K-22 6.06 16.5 46.7 27.2 35.3 AC E-34 5.70 16.1 45.2 77.4 27.6 35.6 K-25 5.00 12.9 38.2 76.3 33.9 E-21 5.84 16.6 45.9 78.6 28.4 26.2 E-35 5.40 16.3 45.5 28.3 35.7

64 HbE-Saskatoon ve HbG-Coushatta
Hematolojik Veriler Adı Soyadı RBC 1012/L Hb g/dL Hct % MCV fL MCH Pg MCHC Hb HPLC Elktr. Mutasyon A. S. 5.99 15.1 44.6 74.5 25.3 33.9 AE AD AE-Saskatoon S.A. 4.28 12.4 36.3 84.9 29.0 34.1 EE DD EE-Saskatoon T. B. 4.46 11.0 76.5 24.7 32.3 AS AE AG-Coushatta Z. B. 4.64 12.5 38.2 82.4 26.9 32.7

65 BETA TALASEMİ GENOTİPLERİ
Klinik Durum Gen durumu Genotip Sağlam / Normal Sessiz taşıyıcı +/ -Thal heterozigot Homozigot +/ -Thal homozigot Beta talasemi intermedia Ağır Taşıyıcı 0/ -Thal heterozigot Homozigot 0 / -Thal homozigot BetaTalasemi Major Kombine Heterozigot +/ -Thal çift heterozigot

66 β-Talasemi Taşıyıcılarına ait Hematolojik Veriler
Cins/ Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH Pg MCHC Tipi HbA2 Beta Globin Genotipi K-26 4.5 10 31 67 21 AA 4.8 IVSI-110 (G>A) E-30 6.8 12 42 61 18 30 IVSI-1 (G>A) E-31 5.6 11 38 69 4.7 Cod 39 (C>T) K-22 5.0 36 72 22 4.1 IVSI-6 (C>T) K-24 5.3 35 5.8 Fsc 8 (AA) K-36 5.2 37 71 5.5 -30 (T>A) K-25 34 66 20 6.1 IVS2-1 (G>A) K-23 65 5.7 IVS2-745 (C>G) K-28 4.0 Fsc5 (-CT) 4.9 33 Fsc 44 (-C) E-26 68 29 4.2 Fsc 74/75 (-C) 40 60 17 3.6 IVSI-5 (G>C) E-21 6.0 41 4.3 Fsc 8/9 (+G)

67 HbS homozigot ve HbS-β-talasemili kişilerin hematolojik değerleri
Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH Pg MCHC Tipi HbF Beta Globin Genotipi K-21 2.22 7.4 22.6 102.0 33.6 32.9 SS 0.3 E-15 5.03 10.7 34.3 68.2 21.4 31.3 SS(F) 9.5 E-17 2.76 8.0 24.8 89.8 28.9 32.2 1.1 E-42 6.08 14.0 45.0 73.9 22.9 31.0 K-7 3.56 11.0 31.5 96.8 30.9 31.9 14.5 E-9 2.67 6.6 22.7 85.0 24.6 SD 0.9 5.18 11.7 37.9 73.2 27.7 SE 2.2 K-17 4.16 8.5 29.5 70.9 20.6 30.7 3.4 S/IVSI-1 K-6 2.99 96.4 31.7 S/Fsc5 K-23 10.5 33.0 65.6 20.9 31.8 SF 15.8 S/IVSI-5 E-12 6.10 13.1 39.5 67.6 22.5 37.5 1.7 S/IVSI-6 E-2 4.55 8.8 29.4 64.5 19.4 30.1 2.0 S/IVSI-110 E-20 2.75 6.0 70.5 21.6 10.0 S/Cd39

68 HbDD, HbD-β-Talasemi ve HbE-β-talasemili kişilerin hematolojik değerleri
Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH Pg MCHC Tipi HbF Beta Globin Genotipi E-33 4.24 11.4 32.8 77.5 26.8 34.6 DD 0.4 K-27 4.67 11.7 39.2 73.3 25.1 34.2 1.7 K-18 6.06 12.3 39.8 65.5 20.3 30.9 1.4 D/IVSI-1 E-25 5.98 12.2 39.6 66.2 20.4 30.8 2.3 D/Fsc5 K-48 5.34 11.1 33.9 63.4 20.8 32.9 1.1 D/IVSI-110 K-11 12.1 38.6 64.6 31.3 E-1 8.5 28.1 60.1 18.2 30.4 EE 1.2 E/IVSI-6 E-40 4.26 10.4 35.4 83.2 24.5 29.4 EF 10.0 E/IVSI-110

69 Alfa talasemi Genotipi
Delesyonel ve nondelesyonel alfa talasemi taşıyıcıların hematolojik verileri Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH pg MCHC Hb Tipi Hb A2 Alfa talasemi Genotipi Erkek n:5 4.82 13.9 44 92.3 28.8 31.2 AA 2.5 αα/αα Kadın n:7 4.69 13.6 43 93.2 29.0 31.1 E-12 5.26 12.5 41 77.9 23.8 30.5 2.1 - α(3.7)/αα K- 22 4.57 11.9 36 80.0 26.0 32.6 3.0 - α(4.2)/αα K-25 5.25 10.8 35 70.2 21.4 30.4 2.0 --(17.4)/αα E -14 6.64 12.7 42 63.7 19.1 30.0 1.9 --(20.5)/ αα K- 43 5.57 10.9 37 67.9 19.6 2.4 --(26.5)/ αα E -15 4.47 12.8 38 85.6 28.5 33.3 1.4 αα/α5nt α E -28 5.22 13.3 46 89.1 25.5 28.6 αα/ αPA1 α K-29 5.20 13.4 80.9 25.8 31.8 αα/αPA2 α E: Erkek, K: Kadın, *MED I, **MED II, 5nt: 5 nüleotid delesyonu (-TGAGG), PA1: AATAAA→AATAAG, PA2: AATAAA→AATGAA

70 HbS ile Delesyonel veya Nondelesyonel Alfa Talasemi Kombinasyonları
Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH pg MCHC Hb Tipi Hb A2 Alfa talasemi Genotipi K-30 4.79 14.0 44 92.3 29.2 31.7 AS 3.1 αα/αα E-33 4.48 13.0 40 90.6 29.0 32.0 3.5 K-7 5.01 13.4 88.8 26.7 30.1 - α(3.7)/αα K-27 4.63 12.3 86.4 26.6 30.7 3.3 - α(4.2)/αα E-32 6.22 13.7 43 70.2 22.0 31.3 4.0 --(17.4)/αα K-29 5.20 10.4 33 63.9 20.0 --(20.5)/αα E-14 5.16 11.3 35 69.6 21.9 31.5 3.7 --(26.5)/αα E-52 5.95 17.8 54 90.9 29.9 32.9 αα/αPA2 α K-20 5.70 9.2 31 55.5 16.1 1.2 --(17.4)/-α(3.7) E-30 6.09 10.8 36 60.4 17.7 29.3 1.4 --(26.5)/αPA2 α

71 Alfa talasemi ve orak hücre taşıyıcılarında Hb, MCV ve HbS değerleri
Alfa genotipi Hb (g/dL) MCV (fL) Hb Tipi HbS (%) αα/αα 13-15 80-90 AS 35-45 -α/αα 13-14 75-85 30-35 -α/-α 12-13 70-75 25-30 --/ αα 11-13 69-73 --/-α 7-10 50-55 17-25

72 Çukurova Bölgesinde Görülen HbH Genotipleri
Cins/Yaş RBC 1012/L Hb g/dL Hct % MCV fL MCH pg MCHC Hb Tipi Hb A2 Hb H Genotipi E-16 4.72 8.8 30 64.0 18.7 29.2 AH 1.7 -- (MED I)/-α(3.7) K-45 4.67 9.1 35 75.0 20.0 26.0 0.5 -- (20.5)/-α(3.7) K-41 4.71 9.5 34 71.8 20.1 28.0 -- (20.5)/-α(4.2) E-29 5.38 10.3 37 69.4 19.2 22.5 1.4 -- (MED II)/-α(3.7) E-18 4.06 6.4 24 59.0 16.0 27.0 1.5 -- (MED I)/α5ntα K-23 3.81 7.8 26 67.0 30.0 0.8 -- (MED I)/αPA1α E-22 3.28 7.4 31 96.0 22.0 23.0 1.3 -- (20.5)/ααCD59 K-11 4.87 8.6 62.0 18.0 29.0 0.4 -- (MED II)/α5ntα 4.42 33 78.0 24.0 αPA1α/αPA1α

73 Alfa ve beta talasemi kombinasyonu
Anne β-Thal (IVS1-110) ve Baba -Thal-1 (20.5kb del) Family RBC 1012 /L Hb g/dL Hct % MCV fL MCH Pg Elect HbA2 Genotype Anne Z.K.26 4.5 10.1 31.7 67.2 21.3 AA 4.8 IVS1-110 /N Baba M.K.28 6.2 12.3 40.4 64.3 19.6 1.7 - -/ 20.5 kb Erkek K.K.6 9.4 29.0 63.4 20.6 4.2 IVS1-110/ 20.5 kb Kız D.K.2 5.35 9.5 29.5 55.0 17.8 4.3 73

74 Augusta GA, USA


"HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ" indir ppt

Benzer bir sunumlar


Google Reklamları