Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı.

Benzer bir sunumlar


... konulu sunumlar: "HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı."— Sunum transkripti:

1 HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı

2 Hemoglobin A Molekülünün Yapısı

3 Eritrosit Yapısı Çapı µm Kalınlığı merkezde 1 µm Kenarlarda µm Membran kalınlığı6.0 nm

4 Erişkin bir insan kanında HbA (2α2β) %96 HbA 2 (2α2  ) % 3 HbF (2α2γ) % 1

5 Hemoglobin Oksijen ve 2,3 DFG molekülü

6 Normal insan hemoglobinleri Embriyonik Hemoglobinler Fetal Hemoglobin Erişkin Hemoglobinleri Hb Gower 1 (ζ 2 ε 2 )Hb F (α 2 γ 2 )Hb A (α 2 β 2 ) Hb Gower 2 (α 2 ε 2 )Hb A 2 (α 2 δ 2 ) Hb Portland (ζ 2 γ 2 )

7 Alfa ve beta benzer globin gen kümeleri

8 Hb molekülü için alfa ve beta globin genlerinin zincir üretimi

9

10

11

12

13

14

15

16

17

18

19 GAG T gaga

20 HbA Molekülü ve HbS taşıyıcılığı HbAS (2α β A β S ) HbSS (2α2 β S ) HbA (2α2 β ) %97 HbA 2 (2α2  ) %3

21

22

23 Beta talasemi taşıyıcısı HbA (2α2β)  HbA 2 (2α2  )  HbA 2 <%3.7 MCV<78

24 Hematolojik Değerler Normal SınırlarBulunan Değer RBC /L4,10-5,10 Hb g/dL12,3-15,3 Hct %36,0-45,0 MCV fL80,0-96,1 MCH pg27,5-33,2 MCHC g/dL33,4-35,2 Hb ElektroforeziHbAA Hb A 2 %2,5-3,5 Hb F %<1,0 Hb S %35,0-45,0

25 HPLC ile belirlenen HbAX

26 Kan örneği alınır EDTA*Na 2 tüplere konur Bu kan örneğinden sayım yapılır Hemoglobin varyant analizi yapılır Anormal Hb, beta veya alfa talasemi tanısı alır Bu kandaki lökositlereden DNA izole edilir PCR ile mutasyon taraması yapılır Doğum öncesi tanıda CVS de bu mutasyonlar aranır Taşıyıcıların belirlenmesi

27 Prenatal tnı için CVS Alınması

28 RFLP ve ARMS sonuçları A B CVS AA AS SS A B CVS SS

29 Alfa talasemi taşıyıcısı HbA (2α2β)  HbA 2 (2α2  )  HbA 2 <%3.5 HbH (β 4 )

30

31 GTGCA CGCCTCCCTGGACAAGTT CCTGGC TTCTGTAG ACACCGTGCTGACCT CCAAATA CCGTTAAgctggagcctcgg tggccatgcttcttgcccctt gggcctccccccagcccctcctccccttcc tgcacccgtaccccc PolyA gtggtctttaataaagtctgagtgggcggcagccgttgtgtg  g g cctgagtttttt ctgtcccggaatgtgccaacaatgg

32 cvs

33 Delesyonel Alfa Talasemiler

34 ALFA TALASEMİ GENOTİPLERİ Klinik Durum Gen sayısı Genotip Sağlam  /  Normal Sessiz taşıyıcı (  + )-  /   -thal-2 heterozigot Homozigot-  /-   -thal-2 homozigot Ağır Taşıyıcı (  0 ) - -/   -thal-1 heterozigot HbH- -/-   -thal-1/  -thal-2 Bart’s- -/ - -  -thal-1 homozigot Nondelesyonel  -talasemi  *  /  Nondelesyonel  -thal HbH  *  /  *  Non del  -thal homozigot HbH- -/  *   -thal-1/Non del  -thal HbH- -/   *  -thal-1/Non del  -thal * Nokta mutasyonu

35 Talasemi ve Hemoglobin Varyantlarının Yeryüzündeki Dağılımı

36 1326Total globin database giriş 9Methemoglobins 134Unstable hemoglobinler 91Yüksek oksijen affinitesine sahip Hemoglobinler 1081 Substition mutasyonu girişi 159 Delesyon mutasyon girişi 8 Füzyon gen mutasyon girişi 53 İnsersiyon mutasyon girişi 56GGama genini kapsayan giriş 50AGama genini kapsayan giriş 79Delta genini kapsayan giriş 735Beta genini kapsayan giriş 313Alfa2 genini kapsayan giriş 265Alfa1 genini kapsayan giriş 50 Total varyant ile talasemi girişi GLOBİN DATABASE’ DE KAYITLI BULUNAN MUTASYON SAYILARI

37 Hemoglobin Varyantları (n:981) Talasemiler (n:395) HEMOGLOBİNOPATİLER α-varyantları β-varyantları  -varyantları  -varyantları α -Talasemiler β-Talasemiler

38  -Thalassemia Mutations Alpha 3.7 kb del Alpha 17.4 kb del Alpha 20.5 kb del Alpha 26.5 kb del Alpha 4.2 kb del GLOBİN GEN KOMBİNASYONLARI

39 Hemoglobin Varyantları Alfa zincir varyantları………………………… 199……………………. 217 Beta zincir varyantları…………………………355………………… ….362 Gama zincir varyantları…………………… … 68……………………… 70 Delta zincir varyantları………………………… 28…………………..…..32 ¡ki amino asitili varyantlar………………… …18…………………..……19 Hibrit zincirli varyantlar……………………… 10……………………...10 Uzamış zincir varyantları……………………… 13…………………..……13 Diger varyantlar……………………………………….22…………………..…..27 Toplam ……………………………….…………………693*………………….750**………981*** *Huisman THJ, Carver MFH and Efremov GD:A Syllabus of human hemoglobinvariants. Sickle Cell Anemia Foundation. 1996, Augusta GA. USA **Huisman THJ, Carver MFH and Efremov GD:A Syllabus of human hemoglobinvariants. Sickle Cell Anemia Foundation. 1998, Augusta GA. USA ***

40  Hb S  6 Glu  Val  Hb E  26 Glu  Lys  Hb D  121 Glu  Gln  Hb C  6 Glu  Lys  Hb H  4  Hb Barts  4 Anormal Hemoglobinler

41 Oksijen azlığında HbS molekülleri polimerleşir. Eritrositlerin orak şeklini almasına neden olur. Bu olay ile (sickling testi) HbS çok kolay tanımlanır. Homozigot kişilerde orak hücre anemisi ciddi bir sorun olur. Orak hücre taşıyıcıları, hipoksi gibi ekstrem koşullarda oluşan intravasküler sikling dışında herhangi bir klinik bulgu vermez. HbS β6 (GAG→GTG); Glu →Val

42  HbA’dan daha az çözünen HbC, kılcal damarlar içinde eritrositlerin deformasyonunu azaltır.  Eritrositler içinde kristalleşme eğilimi gösterir  Hafif derecede hemolitik anemiye neden olur.  Homozigot HbC hafif seyreden hemolitik anemi ile karakterizedir HbC:  6 (GAG→AAG); Glu  Lys

43 HbD Taşıyıcılarında  klinik  hematolojik veya  fizyolojik olarak bir anormalik gözlenmez.  Homozigot kişilerde orta derecede hemolitik anemi tespit edilmiştir. HbD:  121 (GAG→AAG);Glu  Gln

44 HbE taşıyıcılarında; Kırmızı kan hücrelerinde mikrositoz ve hipokromi ile hafif derecede anemi meydana gelmektedir HbE homozigotlar asemptomatiktir. HbE mutasyonu farklı β-talasemi alleleriyle birlikte anormal fenotip oluşturmaktadır. HbE:  26(GAG→AAG); Glu  Lys

45 Alfa zincir varyantları 14 Beta zincir varyantları 24 Gama zincir varyantları 1 Hibrit zincir varyantları 2 Beta zinciri içinde delesyon ve inversiyon 1 Toplam 42 *Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002 Ülkemizde Tespit Edilen Hb Varyantları * İlk kez Türklerde belirlenen varyant sayısı: 8

46 Ülkemizde Tespit Edilmiş Alfa Zincir Varyantları (n:14)* Hb AdıRezidü/Değişim Mutasyon O-Padova 30Glu→LysGAG→AAG Hasharon 47Asp→HisGAC→CAC Montgomery 48Leu→ArgCTG→CGG Adana* 59Gly→AspGGC→GAC J-Anatolia 61Lys→ThrAAG→ACG Ube-2 68Asn→AspAAC→GAC Q-Iran 75Asp→HisGAC→CAC Moabit 86Leu→ArgCTG→CGG M-Iwate 87His→TyrCAC→TAC Çapa* 94Asp→GlyGAC→GGC G-Georgia 95Pro→LeuCCG→CTG Strumica112His→ArgCAC→CGC J-Meerut (J-Birmingham)120Ala→GluGCG→GAG Costant Spring Amino asit *Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

47 Antalya 3-5Leu-Thr-Pro→Ser-Asp-Ser CTGACTGAG  TCTGACTCT S 6Glu→Val GAT→GTG C 6Glu→Lys GAG→AAG Ankara* 10Ala→Asp GCC→GAC E-Saskatoon 22Glu→Lys GAA→AAA G-Coushatta 22Glu→Ala GAA→GCA D-Iran 22Glu→Gln GAA→CAA E 26Glu→Lys GAG→AAG Knossos 27Ala→Ser GCC→TCC Hakkari* 31Leu→Arg CTG→CGG G-Copenhagen 47Asp→Asn GAT→AAT SummerHill 52Asp→His GAT→AAT Hamadan 56Gly→Arg GGC→CGC Ülkemizde Tespit Edilmiş Beta Zincir Varyantları (n:24) Hb AdıRezidü/Değişim Mutasyon Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

48 Hb AdıRezidü/Değişim Mutasyon J-Antakya*65Lys→MetAAG→ATG City of Hope69Gly→SerGGT→AGT J-Iran77His→AspCAC→GAC G-Szuhu80Asn→LysAAC→AAA veya AAG Istanbul /Saint Etienne 92His→GlnCAC→CAA veya CAG N-Batimore95Lys→GluAAG→GAG Köln98Val→MetGTG→ATG Los Angeles (D-Punjab)121Glu→GlnGAA→CAA O-Arab121Glu→LysGAA→AAA Beograd121Glu→ValGAA→GTA Sarrebourg131Gln→ArgCAG→CGG Bronckton138Gln→ArgGCT→CCT Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002 Ülkemizde Tespit Edilmiş Beta Zincir Varyantları (n:24)

49 Ülkemizde Tespit Edilmiş Unstable Zincir Varyantları Hb AdıRezidü/Değişim Mutasyon Hasharonα47 Asp→HisGAC→CAC Adanaα59 Gly→AspGGC→GAC Moabitα86 Leu→ArgCTG→CGG Çapaα94 Asp→GlyGAC→GGC Hakkariβ31 Lue→ArgCTG→CGG İstanbul (St Etienne) β92 His→GlnCAC→CAA veya CAG Kölnβ98 Val→MetGTG→ATG Constant Springα142 (+31 aa)TAA→CAA Antalya β 3-5Leu-Thr-Pro→Ser-Asp-Ser CTGACTGAG  TCTGACTCT Altay Ç. Abnormal hemoglobins in Turkey. 19(1):63, 2002

50 Hemoglobinopati alt grupları Hemoglobinopati Türü Hemoglobin Varyantları Alfa Talasemiler Beta Talasemiler Toplam Sayı Dünya (n) Türkiye (n) 1000< < < < 105

51 Bazı Yeni Mutasyon Türleri Mutasyon Türü ve yeri Hb Adana  1 geni IVS1-117  1 geni Poly A  2 geni IVS2-850  geni Yayınlanan Dergi ve yılı Am J Hematol 1993 Br J Hematol 1993 Br J Hematol 1992 Hemoglobin 1995

52 Çürük MA, Howard SC, Kutlar A, Huisman TH.Çürük MA, Howard SC, Kutlar A, Huisman TH. A newly discovered beta O- thalassemia (IVS-II-850, G  A) mutation in a north European family. Hemoglobin May-Jul;19(3-4): Çürük MA, Dimovski AJ, Baysal E, Gu LH, Kutlar F, Molchanova TP, Webber BB, Altay C, Gürgey A, Huisman THÇürük MA, Dimovski AJ, Baysal E, Gu LH, Kutlar F, Molchanova TP, Webber BB, Altay C, Gürgey A, Huisman TH Hb Adana or alpha 2(59)(E8)Gly  Asp beta 2, a severely unstable alpha 1-globin variant, observed in combination with the -(alpha)20.5 Kb alpha-thal-1 deletion in two Turkish patients. Am J Hematol Dec;44(4): Çürük MA, Baysal E, Gupta RB, Sharma S, Huisman TH.Çürük MA, Baysal E, Gupta RB, Sharma S, Huisman TH. An IVS-I-117 (G  A) acceptor splice site mutation in the alpha 1-globin gene is a nondeletional alpha-thalassaemia-2 determinant in an Indian population. Br J Haematol Sep;85(1): Yüregir GT, Aksoy K, Çürük MA, Dikmen N, Fei YJ, Baysal E, Huisman TH. Hb H disease in a Turkish family resulting from the interaction of a deletional alpha- thalassaemia-1 and a newly discovered poly A mutation. Br J Haematol Apr;80(4):527-32

53 Hb tiplendirmesi  Hb elektroforezi  İzoelektrofokusing (IEF)  High Performance Liquid Chromatography (HPLC) ANORMAL HEMOGLOBİNLER

54 Hb Elektroforezi (-) (+)

55 AE AE AA SE AE SF AS AH AS AS AA AS AH AH AA Hb Elektroforezi

56 İ zoelektrofokusing (IEF)

57 IEF Sonuçları

58 High Performance Liquid Chromatography (HPLC)

59 HbS’nin HPLC’de Ayırımı Hb D’nin HPLC’de Ayırımı

60 HbC’nin HPLC’de Ayırılması HbE’nin HPLC’de Ayırılması

61 HbAE nin HPLC ile Ayrılması HbEE-Saskatoon’nun HPLC ile Ayrılması

62 HbS ve HbD Taşıyıcılarına Ait Hematolojik Veriler Cins/Y aş RBC /L Hb g/dL Hct % MCV fL MCH Pg MCHC g/dL Hb Tipi β-globin Genotipi E AS E AS E AS K AS K AS E AD K AD E AD K AD E AD K AD

63 HbE ve HbC Taşıyıcılarına Ait Hematolojik Veriler Cins/Yaş RBC /L Hb g/dL Hct % MCV fL MCH Pg MCHC g/dL Hb Elektr. Beta Globin Genotipi K AE K AE E AE E AE K AE K AC E AC K AC E AC E AC

64 Adı Soyadı RBC /L Hb g/dL Hct % MCV fL MCH Pg MCHC g/dL Hb HPLC Elktr. Mutasyon A. S AE AD AE- Saskatoon S.A EE DD EE- Saskatoon T. B AS AE AG- Coushatta Z. B AS AE AG- Coushatta HbE-Saskatoon ve HbG-Coushatta Hematolojik Veriler

65 BETA TALASEMİ GENOTİPLERİ Klinik Durum Gen durumu Genotip Sağlam  /  Normal Sessiz taşıyıcı  + /   -Thal heterozigot Homozigot  + /  +  -Thal homozigot Beta talasemi intermedia Ağır Taşıyıcı  0 /   -Thal heterozigot Homozigot  0 /  0  -Thal homozigot BetaTalasemi Major Kombine Heterozigot  + /  0  -Thal çift heterozigot Beta talasemi intermedia

66 Cins/ Yaş RBC /L Hb g/dL Hct % MCV fL MCH Pg MCHC g/dL Hb Tipi Hb A 2 % Beta Globin Genotipi K AA 4.8IVSI-110 (G>A) E AA 4.8IVSI-1 (G>A) E AA 4.7Cod 39 (C>T) K AA 4.1IVSI-6 (C>T) K AA 5.8Fsc 8 (AA) K AA (T>A) K AA 6.1IVS2-1 (G>A) K AA 5.7IVS2-745 (C>G) K AA 4.0Fsc5 (-CT) K AA 4.0Fsc 44 (-C) E AA 4.2Fsc 74/75 (-C) E AA 3.6IVSI-5 (G>C) E AA 4.3Fsc 8/9 (+G) β-Talasemi Taşıyıcılarına ait Hematolojik Veriler

67 HbS homozigot ve HbS-β-talasemili kişilerin hematolojik değerleri Cins/Yaş RBC /L Hb g/dL Hct % MCV fL MCH Pg MCHC g/dL Hb Tipi HbF % Beta Globin Genotipi K SS0.3SS E SS(F)9.5SS E SS1.1SS E SS1.1SS K SS(F)14.5SS E SD0.9SD E SE2.2SE K SS(F)3.4S/IVSI-1 K SS0.9S/Fsc5 K SF15.8S/IVSI-5 E SS1.7S/IVSI-6 E SS2.0S/IVSI-110 E SF10.0S/Cd39

68 HbDD, HbD-β-Talasemi ve HbE-β-talasemili kişilerin hematolojik değerleri Cins/Yaş RBC /L Hb g/dL Hct % MCV fL MCH Pg MCHC g/dL Hb Tipi HbF % Beta Globin Genotipi E DD0.4DD K DD1.7DD K DD1.4D/IVSI-1 E DD2.3D/Fsc5 K DD1.1D/IVSI-110 K DD1.7D/IVSI-110 E EE1.2E/IVSI-6 E EF10.0E/IVSI-110

69 Delesyonel ve nondelesyonel alfa talasemi taşıyıcıların hematolojik verileri E: Erkek, K: Kadın, *MED I, **MED II, 5nt: 5 nüleotid delesyonu (-TGAGG), PA1: AATAAA→AATAAG, PA2: AATAAA→AATGAA Cins/Yaş RBC /L Hb g/dL Hct % MCV fL MCH pg MCHC g/dL Hb Tipi Hb A 2 % Alfa talasemi Genotipi Erkek n: AA2.5αα/αα Kadın n: AA2.5αα/αα E AA2.1 - α (3.7)/ αα K AA3.0 - α (4.2)/ αα K AA2.0 --(17.4)/ αα E AA1.9 --(20.5)/ αα K AA2.4 --(26.5)/ αα E AA1.4 αα / α 5nt α E AA2.5 αα / α PA1 α K AA1.9 αα / α PA2 α

70 HbS ile Delesyonel veya Nondelesyonel Alfa Talasemi Kombinasyonları Cins/YaşRBC /L Hb g/dL Hct % MCV fL MCH pg MCHC g/dL Hb Tipi Hb A 2 % Alfa talasemi Genotipi K AS3.1 αα / αα E AS3.5 αα / αα K AS3.5 - α (3.7)/ αα K AS3.3 - α (4.2)/ αα E AS4.0 --(17.4)/ αα K AS3.3 --(20.5)/ αα E AS3.7 --(26.5)/ αα E AS3.3 αα / α PA2 α K AS1.2 --(17.4)/- α (3.7) E AS1.4 --(26.5)/ α PA2 α

71 Alfa talasemi ve orak hücre taşıyıcılarında Hb, MCV ve HbS değerleri Alfa genotipiHb (g/dL)MCV (fL)Hb TipiHbS (%) αα/αα AS α/αα AS α/-α AS / αα AS /-α AS17-25

72 Çukurova Bölgesinde Görülen HbH Genotipleri Cins/Yaş RBC /L Hb g/dL Hct % MCV fL MCH pg MCHC g/dL Hb Tipi Hb A 2 % Hb H Genotipi E AH1.7-- (MED I)/-α(3.7) K AH0.5-- (20.5)/-α(3.7) K AH0.5-- (20.5)/-α(4.2) E AH1.4-- (MED II)/-α(3.7) E AH1.5-- (MED I)/α 5nt α K AH0.8-- (MED I)/α PA1 α E AH1.3-- (20.5)/αα CD59 K AH0.4-- (MED II)/α 5nt α E AH0.8 α PA1 α/α PA1 α

73 FamilyRBC /L Hb g/dL Hct % MCV fL MCH Pg Hb Elect HbA 2 % Genotype Anne Z.K AA4.8 IVS1-110 /N Baba M.K A /  20.5 kb Erkek K.K AA4.2 IVS1-110/ 20.5 kb Kız D.K A4.3 IVS1-110 /N Alfa ve beta talasemi kombinasyonu Anne β-Thal (IVS1-110) ve Baba  -Thal-1 (20.5kb del)

74 Augusta GA, USA


"HEMOGLOBİN YAPISI SENTEZİ ve EVRİMİ Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı." indir ppt

Benzer bir sunumlar


Google Reklamları