Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

ASTIMDA GENETİK ÇALIŞMALAR Dr. Ömer KALAYCI Hacettepe Üniversitesi Tıp Fakültesi.

Benzer bir sunumlar


... konulu sunumlar: "ASTIMDA GENETİK ÇALIŞMALAR Dr. Ömer KALAYCI Hacettepe Üniversitesi Tıp Fakültesi."— Sunum transkripti:

1 ASTIMDA GENETİK ÇALIŞMALAR Dr. Ömer KALAYCI Hacettepe Üniversitesi Tıp Fakültesi

2 Mendelian – Kompleks Hastalıklar Mendelian Kistik fibrozis Nadir Tek gen Ağır mutasyonlar Büyük fenotipik efekt Kompleks Astım, allerji Sık Birçok gen Hafif mutasyonlar Küçük fenotipik etki

3 Genler Çevre Astım Genler

4 ASTIM İLE İLİŞKİLİ GENLERİN ARAŞTIRILMASI METODLAR

5 astım genlerinin araştırılması (I) Aday gen çalışmaları

6 Bilinen SNP lerin tanımlanması Tanımlanmamaış SNP lerin bulunması Aday gen çalışmaları

7 Exon1 Intron 1Exon 2Intron 2Exon 3 5' 3' Yabanıl tip TGTTAGGGCCCCCCTCCCTGAA Mutant tip TGTTAGGGTCCCCCTCCCTGAA -159

8 AGGGTCACACAGCTTGTTAGTGACACCTGGAA T CTGGAACAAAGATTGCTCATCTCCTTTCCTCGT TCACCTTTCTTGCTGTTCTGGGCTGACCTTCTCT GCCTCCTCCAGCTCAGCCCAGCTTCTGTCTCGG TACCGACCTCGGCC GGCC GGCC GGCCTTATG GCAGCAGTCATTGCTGTCACCCGCTCTGCCCAG GCTGCCCGCCAGGTCCACTTATGCCGAGGAGTC TTCCCCTTGCTTTACCGTGAACCTCCAGAAGCC ATCTGGGCAGATGATGTAGATCGCCGGGTGCAA TTTGGCATTGAAAGTGGTGAGCTACCTAGACCT TCCCTGCCACTCCTACCATTTGTATCAGGAGCCC CCCAACCCAGCTTCCCATACCCACTCAAAGGGC CTTGCCT CTCTCCTGTG GTCCCAGGTT TTCCCTGTGA GAGTCACTAA

9 X geninde gösterilen polimorfizmler Ulrich Wahn’ın makalesinden tablo 2 eklenecek. Bierbaum S. ARJCCM 2005 Sep

10 yabanıl C A A T C T A G G C mutant

11 X geni promoter Bölgesinde saptanan SNP Jel görüntüsü

12 TTCAACCATTTT TCCAACCATTCT

13 SAĞLIKLIASTIMp n X geni Normal Heterezigot Mutant 153 (0.814) 33 (0.176) 2 (0.011) 316 (0.798) 75 (0.189) 5 (0.013) >0.05

14 KARDİOPULMONER HASTALIKLARDA FENOTİPLER Kardiovasküler Koroner arter hst İkincil Hipertansiyon Serum kolesterol HLDL/LDL/Trigliserid Sol vent hipertrofisi Solunum AstIM İkincil Bronş aşırı duyarlılığı Serum IgE düzeyleri Atopi İnflamatuvar belirteçler Solunum fonksiyonları Astım şiddeti

15 Kontrolhafifortaağır mm + mw genotype

16 İLİŞKİLENDİRME ÇALIŞMASI (ASSOCIATION) Hastalık ve hastalık fenotipleri çok iyi tanımlanmalı Büyük olgu kontrol grubu sağlanmalı Gelişigüzel (random) seçilmeli Olgu-kontrol grupları dengeli olmalı Fenotipler çok iyitanımlanmalı

17 TANIMLANAN SNP’İN İŞLEVİ NE?

18 Exon1 Intron 1Exon 2Intron 2Exon 3 5' 3' Yabanıl tip TGTTAGGGCCCCCCTCCCTGAA Mutant tip TGTTAGGGTCCCCCTCCCTGAA -159 GGCCC TF GGTCC X

19 Kalaycı O, AJRCMB 2003

20 astım genlerinin araştırılması (II) Genom boyu tarama + Pozisyonel klonlama

21 Am J Hum Genet 2001;68: Genom boyu tarama Hastalığı taşıyan aileler Polimorfik belirteçler Hastalık ile kromozomal bölge arasında istatistiksel bağlantı (linkage analizi) 5q, 6p, 12q, 13q

22 460 aile En az iki astımlı kardeş Genom boyu tarama + Linkage analizi 20 kromozomun kısa kolunda bir DNA bölgesi Etkilenen kardeşlerde X1000 daha sık Polimorfik belirteçler ADAM 33 20p13

23 Pozisyonel klonlama Fonksiyonunu bilmeksizin bir hastalık geninin tanımlanması Bilinmeyen bir genin tanımlanması

24 astım genlerinin araştırılması (III) Genom boyu polimorfizm taraması

25

26 ORMDL3 p= Endoplasmik retikulumda bulunan transmembran protein

27 Astım ve atopi ile ilişkili fentotiplerle >10 bağımsız çalışmada ilişkili bulunan genler IL-4 IL-13 CD14 ADRB2 HLA-DRB1 HLA-DQB1 TNF FCεR1β IL4Rα ADAM 33

28 Astımın ailevi özelliği vardır. Genetik polimorfizmler astım riskini etkiler Çevresel faktörler astım riskini etkiler Genetik yatkınlıkla çevresel faktörler arasında çok sıkı bir ilişki vardır

29 Astma genetiği Astma genlerinin araştırılması Fizyopatoloji Presemptomatik tedavi Koruyucu tedavi Fonksiyonel genomik çalışmalar Farmakogenetik

30 Astım Farmakogenetiği Genetik bilgiyi kullanarak hangi hastanın tedaviye iyi / kötü yanıt vereceğini saptamak

31 Populasyon değişkenliği Plasebo Çıft kör “izlem” Aktıf Tedavı 2 hafta 12 hafta Montelukast Beclomethasone* Malmstrom et al. Ann Intern Med. 1999;130: FEV 1 12 hafta

32 % değişiklik (ort ± SE) Hafta Beclomethasone Montelukast Bazal=2.2 L Malmstrom et al. Arch Intern Med. 1999;130: FEV 1

33 < to < to < to <0 0 to <10 10 to <20 20 to <30 30 to <40 40 to <50 ³50 Hastaların yüzdesi Beclomethasone Montelukast FEV 1 Bazal değerden % değişiklik Malmstrom et al. Ann Intern Med. 1999;130: Populasyon değişkenliği

34 Liggett et al. AJRCCM, 1997

35 Run-in 6 hafta Randomize kör tedavi 16 hafta Placebo inhaler 4x+ Gerektikçe salbutamol Run-out 4 hafta Salbutamol inhaler x4 + Gerektikçe salbutamol NHLBI BAGS ÇALIŞMASI

36 BAGS Genetik Analiz Randomizasyon sonrası hafta Arg/Arg-LH Gly/Gly - Düzenli Arg/Arg-Düzenli  Sabah PEF (L/min) Israel EJ et al., AJRCCM; 2000

37 Genetik çalışmalar astım tanı ve tedavisinde önümüzdeki yılların en önemli beklentisidir SONUÇ


"ASTIMDA GENETİK ÇALIŞMALAR Dr. Ömer KALAYCI Hacettepe Üniversitesi Tıp Fakültesi." indir ppt

Benzer bir sunumlar


Google Reklamları