Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

ASTIMDA GENETİK ÇALIŞMALAR

Benzer bir sunumlar


... konulu sunumlar: "ASTIMDA GENETİK ÇALIŞMALAR"— Sunum transkripti:

1 ASTIMDA GENETİK ÇALIŞMALAR
Dr. Ömer KALAYCI Hacettepe Üniversitesi Tıp Fakültesi

2 Mendelian – Kompleks Hastalıklar
Kistik fibrozis Nadir Tek gen Ağır mutasyonlar Büyük fenotipik efekt Kompleks Astım, allerji Sık Birçok gen Hafif mutasyonlar Küçük fenotipik etki

3 Genler Genler Çevre Astım

4 ASTIM İLE İLİŞKİLİ GENLERİN ARAŞTIRILMASI
METODLAR

5 astım genlerinin araştırılması (I)
Aday gen çalışmaları

6 Aday gen çalışmaları Bilinen SNP lerin tanımlanması
Tanımlanmamaış SNP lerin bulunması

7 Yabanıl tip TGTTAGGGCCCCCCTCCCTGAA Mutant tip TGTTAGGGTCCCCCTCCCTGAA
Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 5' ' Yabanıl tip TGTTAGGGCCCCCCTCCCTGAA Mutant tip TGTTAGGGTCCCCCTCCCTGAA -159

8 AGGGTCACACAGCTTGTTAGTGACACCTGGAA
T CTGGAACAAAGATTGCTCATCTCCTTTCCTCGTTCACCTTTCTTGCTGTTCTGGGCTGACCTTCTCTGCCTCCTCCAGCTCAGCCCAGCTTCTGTCTCGGTACCGACCTCGGCC GGCC GGCC GGCCTTATG GCAGCAGTCATTGCTGTCACCCGCTCTGCCCAGGCTGCCCGCCAGGTCCACTTATGCCGAGGAGTCTTCCCCTTGCTTTACCGTGAACCTCCAGAAGCCATCTGGGCAGATGATGTAGATCGCCGGGTGCAATTTGGCATTGAAAGTGGTGAGCTACCTAGACCTTCCCTGCCACTCCTACCATTTGTATCAGGAGCCCCCCAACCCAGCTTCCCATACCCACTCAAAGGGCCTTGCCT CTCTCCTGTG GTCCCAGGTT TTCCCTGTGA GAGTCACTAA

9 X geninde gösterilen polimorfizmler
Ulrich Wahn’ın makalesinden tablo 2 eklenecek. Bierbaum S. ARJCCM 2005 Sep

10 yabanıl C A A T C T A G G C mutant

11 X geni promoter Bölgesinde saptanan SNP Jel görüntüsü

12 TTCAACCATTTT TCCAACCATTCT 217 119 98

13 SAĞLIKLI ASTIM p n 188 396 X geni Normal Heterezigot Mutant >0.05
153 (0.814) 33 (0.176) 2 (0.011) 316 (0.798) 75 (0.189) 5 (0.013) >0.05

14 KARDİOPULMONER HASTALIKLARDA FENOTİPLER
Kardiovasküler Koroner arter hst İkincil Hipertansiyon Serum kolesterol HLDL/LDL/Trigliserid Sol vent hipertrofisi Solunum AstIM İkincil Bronş aşırı duyarlılığı Serum IgE düzeyleri Atopi İnflamatuvar belirteçler Solunum fonksiyonları Astım şiddeti

15 5 10 15 20 25 30 35 40 45 Kontrol hafif orta ağır mm + mw genotype

16 İLİŞKİLENDİRME ÇALIŞMASI (ASSOCIATION)
Hastalık ve hastalık fenotipleri çok iyi tanımlanmalı Büyük olgu kontrol grubu sağlanmalı Gelişigüzel (random) seçilmeli Olgu-kontrol grupları dengeli olmalı Fenotipler çok iyitanımlanmalı

17 TANIMLANAN SNP’İN İŞLEVİ NE?

18 TF X GGTCC GGCCC Yabanıl tip TGTTAGGGCCCCCCTCCCTGAA
Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 5' ' Yabanıl tip TGTTAGGGCCCCCCTCCCTGAA Mutant tip TGTTAGGGTCCCCCTCCCTGAA -159 TF X GGCCC GGTCC

19 Kalaycı O, AJRCMB 2003

20 astım genlerinin araştırılması (II)
Genom boyu tarama + Pozisyonel klonlama

21 Genom boyu tarama Hastalığı taşıyan aileler Polimorfik belirteçler
Hastalık ile kromozomal bölge arasında istatistiksel bağlantı (linkage analizi) 5q, 6p, 12q, 13q Am J Hum Genet 2001;68:

22 ADAM 33 20p13 460 aile En az iki astımlı kardeş
Genom boyu tarama + Linkage analizi 20 kromozomun kısa kolunda bir DNA bölgesi Etkilenen kardeşlerde X1000 daha sık Polimorfik belirteçler ADAM 33 20p13

23 Pozisyonel klonlama Fonksiyonunu bilmeksizin bir hastalık geninin tanımlanması Bilinmeyen bir genin tanımlanması

24 astım genlerinin araştırılması (III)
Genom boyu polimorfizm taraması

25

26 Endoplasmik retikulumda bulunan transmembran protein
ORMDL3 p=10-22 Endoplasmik retikulumda bulunan transmembran protein

27 Astım ve atopi ile ilişkili fentotiplerle >10 bağımsız çalışmada ilişkili bulunan genler
CD14 ADRB2 HLA-DRB1 HLA-DQB1 TNF FCεR1β IL4Rα ADAM 33

28 Astımın ailevi özelliği vardır.
Genetik polimorfizmler astım riskini etkiler Çevresel faktörler astım riskini etkiler Genetik yatkınlıkla çevresel faktörler arasında çok sıkı bir ilişki vardır

29 Astma genetiği Astma genlerinin araştırılması
Fizyopatoloji Presemptomatik tedavi Koruyucu tedavi Fonksiyonel genomik çalışmalar Farmakogenetik

30 Astım Farmakogenetiği
Genetik bilgiyi kullanarak hangi hastanın tedaviye iyi / kötü yanıt vereceğini saptamak

31 Populasyon değişkenliği
Montelukast FEV1 12 hafta Beclomethasone* Plasebo Çıft kör “izlem” Aktıf Tedavı 2 hafta hafta Malmstrom et al. Ann Intern Med. 1999;130:

32 FEV1 Beclomethasone Montelukast 17 15 13 11 9 7 5 3 1 -1 -3
% değişiklik (ort ± SE) Montelukast 35. Chronic Asthma Beclomethasone Comparison Study: Effects on FEV1 (Multinational Study) In the multinational chronic asthma study, in all measured endpoints, both active treatments were significantly better than placebo. Beclomethasone had a significantly greater average effect than montelukast: mean FEV1 of 7.49 ± 0.88 in the montelukast group vs ± 1.26 in the beclomethasone group. This slide demonstrates the percent change from baseline in FEV1 – the primary endpoint of the study for all three treatment groups. The effects of both montelukast and inhaled beclomethasone were lost within three weeks on withdrawal of therapy. The decline of effect was slow and similar for montelukast and beclomethasone, suggesting that the effects persisted for some time; this was evident when analyzing diary and parameters day by day. Neither agent showed evidence of rebound worsening.12, 13 3 6 9 12 Hafta Bazal=2.2 L Malmstrom et al. Arch Intern Med. 1999;130: 8.16

33 Populasyon değişkenliği
30 25 Beclomethasone Hastaların yüzdesi Montelukast 20 15 10 36. Chronic Asthma Beclomethasone Comparison Study: Distribution of FEV1 Response To explore further the differences between inhaled beclomethasone and montelukast, the distribution of response for FEV1 was examined. This frequency plot demonstrates a bell-shaped curve for both montelukast and beclomethasone based on the percent change in FEV1 from baseline. This distribution is unimodal for both agents, showing no separation of responding versus non-responding populations. Rather, a range of responses exists for both treatments. The distribution of response between treatment groups was generally similar.12, 13 5 <-30 -30 to <-20 -20 to <-10 -10 to <0 0 to <10 10 to <20 20 to <30 30 to <40 40 to <50 ³50 FEV1 Bazal değerden % değişiklik Malmstrom et al. Ann Intern Med. 1999;130: 8.16

34 b2AR Polimorfizmleri ¨ ¬ Arg 16 Gly (AGA GGA) Gln 27 Glu (CAA GAA)
Q P N S A F L R H D V T E W I K Y C AI b2AR Polimorfizmleri 84 (CTG CTA) 413 (CTG CTA) HOOC 366 (TAT TAC) 351 (GGG GGC) 175 (CGG AGG) Gln Glu (CAA GAA) Arg Gly (AGA GGA) NH2 Val Met (GTG ATG) Thr Ile (ACC ATC) Liggett et al. AJRCCM, 1997

35 NHLBI BAGS ÇALIŞMASI Salbutamol inhaler x4 + Gerektikçe salbutamol
Randomize kör tedavi 16 hafta Run-out 4 hafta Run-in 6 hafta Placebo inhaler 4x+ Gerektikçe salbutamol

36 BAGS Genetik Analiz Arg/Arg-LH Gly/Gly-Düzenli  Sabah PEF (L/min)
10 5 -5  Sabah PEF (L/min) -10 Arg/Arg-Düzenli -15 -20 -25 5 10 15 20 Randomizasyon sonrası hafta Israel EJ et al., AJRCCM; 2000 14 10

37 SONUÇ Genetik çalışmalar astım tanı ve tedavisinde
önümüzdeki yılların en önemli beklentisidir


"ASTIMDA GENETİK ÇALIŞMALAR" indir ppt

Benzer bir sunumlar


Google Reklamları