Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

1 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnekler Doç. Dr. Nizamettin AYDIN Introduction to Bioinformatics.

Benzer bir sunumlar


... konulu sunumlar: "1 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnekler Doç. Dr. Nizamettin AYDIN Introduction to Bioinformatics."— Sunum transkripti:

1 1 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnekler Doç. Dr. Nizamettin AYDIN Introduction to Bioinformatics

2 2 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnek 1 Aşağıda verilen DNA yı RNA ya kopyalayın (transcription). Bulduğunuz genetik kodu kullanarak DNA yı amino asit dizisine (sequence of amino acids) dönüştürünüz (translation) TCATAATACGTTTTGTATTCGCCAGCGC TTCGGTGT

3 3 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Çözüm 1... DNA yı kopyalamak için önce G yerine C, C yerine G, T yerine A ve A yerine T yazarak DNA nın bir kopyasını çıkarın. TCATAATACGTTTTGTATTCGCCAGCGCTTCGGTGT AGTATTATGCAAAACATAAGCGGTCGCGAAGCCACA RNA için Thymine (T) baselerini e a Uracil (U) le değiştirin: AGUAUUAUGCAAAACAUAAGCGGUCGCGAAGCCACA Genetic kodu bulmak için RNA dizisini üçlü gruplara ayırın: AGU AUU AUG CAA AAC AUA AGC GGU CGC GAA GCC ACA

4 4 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Çözüm 1... Genetic code tablosundan üçlü gruplara (codon) karşı gelen amino asitleri yazın. Örneğin AGU Serine (ser veya S), AUU Isoleucine (Ile veya I) olur: SIMQNISGREAT Ödev: Yukarıdaki işlemleri yapan bir Perl programı yazınız

5 5 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Genetic Code A=Ala=Alanine C=Cys=Cysteine D=Asp=Aspartic acid E=Glu=Glutamic acid F=Phe=Phenylalanine G=Gly=Glycine H=His=Histidine I=Ile=Isoleucine K=Lys=Lysine L=Leu=Leucine M=Met=Methionine N=Asn=Asparagine P=Pro=Proline Q=Gln=Glutamine R=Arg=Arginine S=Ser=Serine T=Thr=Threonine V=Val=Valine W=Trp=Tryptophan Y=Tyr=Tyrosine

6 6 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Alıştırma 1 Yukarıdaki örnekte verilen DNA dizisinin başından bir harf silin ve aynı işlemi tekrarlayın. Sonuç ne olur, yorumlayın.

7 7 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnek 2 Aşağıda verilen iki dizide Hamming uzaklığı (Hamming distance) nedir BIOINFORMATICS_IS_THE BEST_FOR_STRUCTURE_PREDICTION

8 8 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Çözüm 2 Hamming uzaklığını hesaplamak için hizali dizilerdeki karşılıklı aynı olmayan elemanları sayıyoruz: BIOINFORMATICS_IS_THE BEST_FOR_STRUCTURE_PREDICTION 16

9 9 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnek 3 Aşağıdaki iki dizi için, BLOSUM62 substitution matrix ini kullanarak en iyi hizalanışı (best alignment) bulun. FYGNYK DGSFNW

10 10 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” BLOSUM62 Substitution Matrix Zero: by chance –+ more than chance –- less than chance Arranged by –Sidegroups –So, high scoring –in the end boxes Example –M,I,L,V –Interchangeable


"1 “INTRODUCTION TO BIOINFORMATICS” “SPRING 2005” “Dr. N AYDIN” Örnekler Doç. Dr. Nizamettin AYDIN Introduction to Bioinformatics." indir ppt

Benzer bir sunumlar


Google Reklamları