Sunum yükleniyor. Lütfen bekleyiniz

Sunum yükleniyor. Lütfen bekleyiniz

Tıbbi Mikrobiyoloji Anabilim Dalı Somatik Reseptör Geni Üretimi 2015-2016, Bahar, Trakya Üniv Tıp Fak 6. Kurul, 10.03.2016 Neşe Akış, PhD, Tıbbi Mikrobiyoloji.

Benzer bir sunumlar


... konulu sunumlar: "Tıbbi Mikrobiyoloji Anabilim Dalı Somatik Reseptör Geni Üretimi 2015-2016, Bahar, Trakya Üniv Tıp Fak 6. Kurul, 10.03.2016 Neşe Akış, PhD, Tıbbi Mikrobiyoloji."— Sunum transkripti:

1 Tıbbi Mikrobiyoloji Anabilim Dalı Somatik Reseptör Geni Üretimi , Bahar, Trakya Üniv Tıp Fak 6. Kurul, Neşe Akış, PhD, Tıbbi Mikrobiyoloji Anabilim Dalı

2 Eylemci Hücrelerin Özellikleri Özet 1

3 DOĞAL BAĞIŞIKLIK EDİNSEL BAĞIŞIKLIK B lenfositleriCD4+ TCD8+ T Hücrenin gelişme biçimi Kemik iliğinde lökogenez ile Reseptör gen şekli B ve T dışındaki hücrelerin genomda normal genden transkripsiyon Ag tanımaPAMP ile temas Aktiflenme biçimi PAMP ile temas Savunma biçimi Tahrip et ve öl

4 Genomda normal genden transkripsiyon Genom Kromozomda gen lokusu Lokusda genler Gende bölgeler Promotor Ekzon Sonlanma Gen pre mRNA’sı Gen mRNA’sı Ilk ekzon PAMP tanıyan bölge

5 Eylemci Hücrelerin Özellikleri Özet DOĞAL BAĞIŞIKLIK EDİNSEL BAĞIŞIKLIK B lenfositleriCD4+ TCD8+ T Hücrenin gelişme biçimi Kemik iliğinde lökogenez ile Kemik iliğinde lökogenez ardından kemik iliğinde otoantijen için negatif seçilme. Kurtulanlar ölmez, negatif seçilenler ölür. Kemik iliğinde lökogenez ardından timusda MHC için pozitif seçilme ve sonra otoantijen için negatif seçilme Reseptör gen şekli Ag tanıma Aktiflenme biçimi Savunma biçimi

6 Eylemci Hücrelerin Özellikleri Özet DOĞAL BAĞIŞIKLIKEDİNSEL BAĞIŞIKLIK B lenfositleriCD4+ TCD8+ T Hücrenin gelişme biçimi Kemik iliğinde lökogenez ile Kemik iliğinde lökogenez ardından kemik iliğinde otoantijen için negatif seçilme Kemik iliğinde lökogenez ardından timusda MHC için pozitif seçilme ve sonra otoantijen için negatif seçilme Reseptör gen şekli B ve T dışındaki hücrelerin genomda normal genden transkripsiyon Genomdaki reseptör genlerinin epitop tanıyan ilk ekzon bölgesinde çoklu mini ekzonlar var. Seçilmeler başlamadan önce her lenfositte rastgele farklı 3 (kısada 2) mini ekzon birleşerek ilk ekzonu oluşturur, ortaya çıkan yeni genden (somatik reseptör geni) transkripsiyon yapılır Ag tanıma Aktiflenme biçimi Savunma biçimi

7 Genom Kromozomda gen lokusu Lokusda genler Gende bölgeler Promotor Ekzon sonlanma Ekzon 1’de mini ekzonlar V mini ekzon kümesi D mini ekzon kümesi J mini ekzon kümesi Genomdaki reseptör genlerinin epitop tanıyan ilk ekzon bölgesinde çoklu mini ekzonlar var

8 Gende bölgeler Promotor Ekzon sonlanma Ekzon 1’de mini ekzonlar V mini ekzonları D mini ekzonları (kısada yok) J mini ekzonları Rastgele 3 (kısada 2) mini ekzon birleşerek ilk ekzonu oluşturur, ortaya çıkan yeni genden transkripsiyon yapılır İlk ekzonun oluşturulması Promotor Ekzon sonlanma Gende bölgeler Gen pre mRNA’sı Gen mRNA’sı Ilk ekzon epitop tanıyan bölge

9 Eylemci Hücrelerin Özellikleri Özet DOĞAL BAĞIŞIKLIK EDİNSEL BAĞIŞIKLIK B lenfositleriCD4+ TCD8+ T Hücrenin gelişme biçimi Kemik iliğinde lökogenez ile Kemik iliğinde lökogenez ardından kemik iliğinde otoantijen için negatif seçilme Kemik iliğinde lökogenez ardından timusda MHC için pozitif seçilme ve sonra otoantijen için negatif seçilme Reseptör gen şekli Genomda normal genden transkripsiyon Genomdaki reseptör genlerinin ilk ekzon bölgesinde çoklu mini ekzonlar var. Seçilmeler başlamadan önce rastgele 2-3 mini ekzon birleşerek ilk ekzonu oluşturur, ortaya çıkan yeni genden transkripsiyon yapılır Ag tanımaPAMP ile temas Epitop(lar) ile temas MHC-II tarafından sunumda dual temas MHC-I tarafından sunumda dual temas Aktiflenme biçimi Temas1- Çoklu tekrarlayan epitoplarla temas 2- Tek epitopsa Th2’den yardım + eşuyarandan bilgi Eşuyarandan bilgi Savunma biçimi Tahrip et ve öl Antikor sentezle, hafızalı üret Yönet, hafızalı üret Tahrip et, hafızalı üret

10 Epitop CD8 MHC-I veya MHC-II tarafından sunumda dual temas 1) Epitopu tanıyabiliyor mu? 2) Kendi vücuduna ait MHC mi ve uygun MHC’mi? 2) Kendi vücuduna ait MHC mi ve uygun MHC’mi? (Uygunluk: CD8+ T ise MHC-I olacak; CD4+ T ise MHC-II olacak) (Uygunluk: CD8+ T ise MHC-I olacak; CD4+ T ise MHC-II olacak) peptid

11 Eylemci Hücrelerin Özellikleri Özet DOĞAL BAĞIŞIKLIK EDİNSEL BAĞIŞIKLIK B lenfositleriCD4+ TCD8+ T Hücrenin gelişme biçimi Kemik iliğinde lökogenez ile Kemik iliğinde lökogenez ardından kemik iliğinde otoantijen için negatif seçilme Kemik iliğinde lökogenez ardından timusda MHC için pozitif seçilme ve sonra otoantijen için negatif seçilme Reseptör gen şekli Genomda normal genden transkripsiyon Genomdaki reseptör genlerinin ilk ekzon bölgesinde çoklu mini ekzonlar var. Seçilmeler başlamadan önce rastgele 2-3 mini ekzon birleşerek ilk ekzonu oluşturur, ortaya çıkan yeni genden transkripsiyon yapılır Ag tanımaPAMP ile temas Epitop(lar) ile temas MHC-II tarafından sunumda dual temas MHC-I tarafından sunumda dual temas Aktiflenme biçimi PAMP ile temas 1- Çoklu tekrarlayan epitoplarla temas (CD4+ Th2’den yardım almadan) 2- Tek epitopsa CD4+ Th2’den yardım + eşuyarandan bilgi CD4+ Th1’den yardım + eşuyarandan bilgi Savunma biçimi Tahrip et ve öl Antikor sentezle, hafızalı üret Yönet, hafızalı üret Tahrip et, hafızalı üret

12 Eylemci Hücrelerin Özellikleri Özet DOĞAL BAĞIŞIKLIK EDİNSEL BAĞIŞIKLIK B lenfositleriCD4+ TCD8+ T Hücrenin gelişme biçimi Kemik iliğinde lökogenez ile Kemik iliğinde lökogenez ardından kemik iliğinde otoantijen için negatif seçilme Kemik iliğinde lökogenez ardından timusda MHC için pozitif seçilme ve sonra otoantijen için negatif seçilme Reseptör gen şekli Genomda normal genden transkripsiyon Genomdaki reseptör genlerinin ilk ekzon bölgesinde çoklu mini ekzonlar var. Seçilmeler başlamadan önce rastgele 2-3 mini ekzon birleşerek ilk ekzonu oluşturur, ortaya çıkan yeni genden transkripsiyon yapılır Ag tanımaPAMP ile temas Epitop(lar) ile temas MHC-II tarafından sunumda dual temas MHC-I tarafından sunumda dual temas Aktiflenme biçimi Temas1- Çoklu tekrarlayan epitoplarla temas 2- Tek epitopsa CD4+ Th2’den yardım + eşuyarandan bilgi Eşuyarandan bilgi Savunma biçimi Tahrip et ve öl Antikor sentezle, hafızalı üret, öl Yönet, hafızalı üret, öl Tahrip et, hafızalı üret, öl

13 Gama-Delta THR’nin Örnek olarak Gama-Delta THR’nin somatik reseptörünün üretimi 2

14 Gama-Delta THR, gama ve delta THR genlerinden üretilen iki peptitdin birleşerek hücre yüzeyine çıkması ile oluşur δ γ γ δ Delta peptidi Gama peptidi T lenfosit membranı hücredışı

15 γ δ veya γ gen bölgesinin kromozomdaki orijinal hali promotor ekzon2 ekzon3 ekzon4 intron1 intron2intron3 sonlandırıcı Mini ekzonlar kümeler halinde 1nci ekzon yerine

16 V1V2J1D1D2D3J2 V kümesi D kümesiJ kümesi ekzon2 ekzon3 ekzon4 intron1 intron2intron3 Mini ekzonlar 3 küme halinde Lokus 14q11.2’de δ geninin mini ekzon kümeleri J3J4 ATTGTGTGACTGTGCCTGCATACGTATAAGTATGACCTATCGTTATCACCTATATGGTATGACTTCGTAAAGTAAATTGCCAACTCT

17 rastgele yeniden birleşme yapar ve yeni gen oluşur, transkripsiyon ve translasyon bu genden devam eder δ mini ekzonları rastgele yeniden birleşme yapar ve yeni gen oluşur, transkripsiyon ve translasyon bu genden devam eder ekzon2ekzon3 ekzon4 intron1 intron2intron3 V1D3J2 Hücre-1 DNA ekzon2 ekzon3 ekzon4 intron1 intron2intron3 Yeniden birleşme reaksiyonu mRNA minigenler 3 küme halinde Peptid zincir V1V2J1D1D2D3J2 V kümesi D kümesiJ kümesi J3J4 ATTGTGTGACTGTGCCTGCATACGTATAAGTATGACCTATCGTTATCACCTATATGGTATGACTTCGTAAAGTAAATTGCCAACTCT

18 δ1δ1 δ2δ2 Ekzon 2 Ekzon 4 Ekzon 3 V bölgesinden seçilen mini ekzon Antijenin bağlandığı yer MEMBRAN Sabit bölgeye antijen bağlanmaz Delta (peptid yeni geni ve zinciri Delta (δ) peptid yeni geni ve zinciri D bölgesinden seçilen mini ekzon J bölgesinden seçilen mini ekzon DNA zincir

19 Her gama-delta T hücresinde farklı bir δ geni, bu nedenle farklı bir tanıma reseptörü üretilmiştir ekzon2ekzon3 ekzon4 intron1 intron2intron3 ifade düzenleyici sonlandırıcı yeniden birleşme yaptırıcı V1D3J2 Hücre-1 DNA Hücre-2 DNA Hücre-3 DNA V1 V2 D2 D3 J1 J4 ekzon2ekzon3 ekzon4 intron1 intron2intron3 sonlandırıcı ekzon2 ekzon3 ekzon4 intron1 intron2intron3 sonlandırıcı ekzon2ekzon3 ekzon4 intron1 intron2intron3 sonlandırıcı ifade düzenleyici ifade düzenleyici ifade düzenleyici yeniden birleşme mRNA minigenler 3 küme halinde V1V2J1D1D2D3J2 V kümesi D kümesiJ kümesi J3J4 ATTGTGTGACTGTGCCTGCATACGTATAAGTATGACCTATCGTTATCACCTATATGGTATGACTTCGTAAAGTAAATTGCCAACTCT

20 Her gama-delta T hücresi farklı bir PAMP’ı tanır ekzon2ekzon3 ekzon4 intron1 intron2intron3 V1D3J2 Hücre-1 DNA Hücre-2 DNA Hücre-3 DNA ekzon2ekzon3 ekzon4 intron1 intron2intron3 ekzon2ekzon3 ekzon4 intron1 intron2intron3 ifade düzenleyici ifade düzenleyici ifade düzenleyici mRNA V4D2J1 V2D3J1

21 Ekzon 2 Ekzon 4Ekzon 3 VDJ Ekzon-1 δ1δ1δ2δ2 γ1γ1 γ2γ2 Ekzon 2 Ekzon 4Ekzon 3 V Ekzon-1 J Aynı işlem gama (γ) geninde de yapılır. Sadece gama geninde D mini ekzonu bulunmaz, ekzon 1 kısadır

22 Neden somatik reseptör üretimi ? 3

23 δ zincirinin 1nci ekzonundan kaç adet farklı reseptör üretilebilir? 2 X 3 X 4 = 24 adet V1V2J1D1D2D3J2 V kümesi D kümesiJ kümesi J3J4 ATTGTGTGACTGTGCCTGCATACGTATAAGTATGACCTATCGTTATCACCTATATGGTATGACTTCGTAAAGTAAATTGCCAACTCT

24 γ zincirinin 1nci ekzonundan kaç adet farklı reseptör üretilebilir? V1V2J1J2 V kümesi J kümesi V14V15 15 X 5 = 75 adet DNA J1J2 GTGACTGTGCCTGCATACGTATAAGTATGACCTATCGTTAAAGGTTAGTTAGTTATCACCTATATGGTATGACTTCGTAAAGTA

25 24 δ X 75 γ = 1800 farklı γ δ THR δ γ γ δ Kaç adet γ δ THR çeşidi üretilebilir ? SONUÇ: Somatik yeniden birleşme mekanizması sayesinde 1800 reseptör çeşidini 1800 gen yerine 2 gen ve çoklu ekzon ile üretmek mümkün oluyor

26 Somatik reseptör üretimi ile edinsel immünitede reseptör çeşitliliği 4

27  B1 hücrede tek ağır ve iki hafif (κ veya λ) zincir geni  γδ T hücrede γ ve δ zincirlerinin iki adet geni  B2 hücre ile B1 hücre aynı genleri kullanır  αβ (CD4+ veya CD8+) T hücrede α ve β zincirlerinin iki adet geni DOĞAL BAĞIŞIKLIK HÜCRELERİNDE (Mini ekzon kullanımı sınırlı, PRR gibi tanır, hafıza yok)  B1 hücrede tek ağır ve iki hafif (κ veya λ) zincir geni  γδ T hücrede γ ve δ zincirlerinin iki adet geni EDİNSEL BAĞIŞIKLIK HÜCRELERİNDE (Mini ekzon çok, epitop tanır, hafıza var)  B2 hücre ile B1 hücre aynı genleri kullanır  αβ (CD4+ veya CD8+) T hücrede α ve β zincirlerinin iki adet geni Somatik Reseptör üreten B ve T lenfositlerinde reseptör gen sayısı

28 BENZERLİKLER: Somatik Reseptör üreten B ve T lenfositlerinde üretimler aynı gama-delta hücresinin reseptör üretimi gibi gerçekleşir. FARKLAR: 1- Mini ekzon kümelerindeki ekzon sayıları çoktur 2- Yeniden birleşim yerlerinde (CDR bölgeleri) aşırı mutasyonla çeşitlilik arttırılır Yeniden Birleşme İşlemi

29 Kaç adet αβ THR çeşidi üretilebilir ? Mutasyonlar çeşit reseptör ağır zincir

30 veya Kaç adet BHR çeşidi üretilebilir ? Mutasyonlar çeşit reseptör

31 Allelik dışlama mekanizması 5

32 İnsanda diploid kromozom olduğundan her BHR veya THR geni için ikişer lokus bulunur. Lenfositlerin tek tip tanıma reseptörü üretebilmesi için yeniden düzenleme işlemi esnasında diğer allelin ilgili lokusları kapatılır.


"Tıbbi Mikrobiyoloji Anabilim Dalı Somatik Reseptör Geni Üretimi 2015-2016, Bahar, Trakya Üniv Tıp Fak 6. Kurul, 10.03.2016 Neşe Akış, PhD, Tıbbi Mikrobiyoloji." indir ppt

Benzer bir sunumlar


Google Reklamları